Incidental Mutation 'R6509:Olfr847'
ID519866
Institutional Source Beutler Lab
Gene Symbol Olfr847
Ensembl Gene ENSMUSG00000059821
Gene Nameolfactory receptor 847
SynonymsMOR149-2, GA_x6K02T2PVTD-13113073-13112135
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R6509 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location19373668-19378669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19375143 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 246 (V246A)
Ref Sequence ENSEMBL: ENSMUSP00000151112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079620] [ENSMUST00000216839]
Predicted Effect probably benign
Transcript: ENSMUST00000079620
AA Change: V246A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078568
Gene: ENSMUSG00000059821
AA Change: V246A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216839
AA Change: V246A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C T 5: 98,329,397 T15I probably benign Het
4930522L14Rik G A 5: 109,737,384 R203* probably null Het
Ccnc A G 4: 21,740,642 N133D probably benign Het
Lbhd2 A G 12: 111,410,313 R65G possibly damaging Het
Lrrc37a A G 11: 103,504,414 S62P probably benign Het
Map3k1 T A 13: 111,753,829 M1279L possibly damaging Het
Ncapg2 G A 12: 116,427,756 R475Q probably damaging Het
Nlrp5 A T 7: 23,417,916 N355I probably damaging Het
Pdzd8 A G 19: 59,344,866 F241S probably benign Het
Rgl3 A G 9: 21,971,908 S705P probably benign Het
Rsbn1 A G 3: 103,960,032 Y563C probably damaging Het
Sept9 A G 11: 117,290,427 I18V probably benign Het
Sycp2 G A 2: 178,395,894 P153S probably damaging Het
Tbc1d4 C A 14: 101,608,318 R48L possibly damaging Het
Vmn1r195 G A 13: 22,279,109 G250R probably benign Het
Vmn2r66 G T 7: 85,006,846 P321T probably benign Het
Other mutations in Olfr847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Olfr847 APN 9 19375239 missense probably damaging 1.00
IGL01293:Olfr847 APN 9 19375336 missense probably benign 0.23
IGL01879:Olfr847 APN 9 19375407 nonsense probably null
IGL03298:Olfr847 APN 9 19375062 missense probably damaging 1.00
R1350:Olfr847 UTSW 9 19375414 missense possibly damaging 0.94
R1400:Olfr847 UTSW 9 19375062 missense probably damaging 0.98
R2894:Olfr847 UTSW 9 19375292 nonsense probably null
R4468:Olfr847 UTSW 9 19375648 missense probably benign 0.00
R4694:Olfr847 UTSW 9 19375398 missense probably damaging 1.00
R4791:Olfr847 UTSW 9 19375809 missense probably benign 0.28
R4794:Olfr847 UTSW 9 19375545 missense probably benign 0.00
R5517:Olfr847 UTSW 9 19375767 missense probably damaging 1.00
R5599:Olfr847 UTSW 9 19375629 missense possibly damaging 0.77
R5777:Olfr847 UTSW 9 19375718 missense probably benign 0.29
R6505:Olfr847 UTSW 9 19374941 makesense probably null
R7246:Olfr847 UTSW 9 19375465 nonsense probably null
R7659:Olfr847 UTSW 9 19375558 missense probably benign 0.03
R7789:Olfr847 UTSW 9 19375065 missense probably benign 0.33
R7886:Olfr847 UTSW 9 19375906 splice site probably null
R7969:Olfr847 UTSW 9 19375906 splice site probably null
Z1088:Olfr847 UTSW 9 19375684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGAAAGCAAGATACCTTTGTG -3'
(R):5'- TCTTCTGTGAGCTTGCTCAAG -3'

Sequencing Primer
(F):5'- CCTTTGTGATAAGTTTTCCCAAAGC -3'
(R):5'- CTGTGAGCTTGCTCAAGTCATCAAG -3'
Posted On2018-06-06