Mutagenetix > Incidental Mutations

Incidental Mutation 'R6509:Pdzd8'

519875

Institutional Source

Beutler Lab

Gene Symbol

Pdzd8

Ensembl Gene

ENSMUSG00000074746

Gene Name

PDZ domain containing 8

Synonyms

A630041P07Rik, Pdzk8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6509 (G1)

Quality Score

166.009

Status

Not validated

Chromosome

Chromosomal Location

59296084-59345780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59344866 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 241 (F241S)

Ref Sequence

ENSEMBL: ENSMUSP00000096880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099274]

AlphaFold

B9EJ80

Predicted Effect

probably benign
Transcript: ENSMUST00000099274
AA Change: F241S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: F241S

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
low complexity region	75	90	N/A	INTRINSIC
PDZ	374	448	2.02e-10	SMART
low complexity region	582	596	N/A	INTRINSIC
low complexity region	802	814	N/A	INTRINSIC
C1	834	884	8.31e-8	SMART
coiled coil region	1021	1057	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.7%
20x: 92.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	C	T	5: 98,329,397	T15I	probably benign	Het
4930522L14Rik	G	A	5: 109,737,384	R203*	probably null	Het
Ccnc	A	G	4: 21,740,642	N133D	probably benign	Het
Lbhd2	A	G	12: 111,410,313	R65G	possibly damaging	Het
Lrrc37a	A	G	11: 103,504,414	S62P	probably benign	Het
Map3k1	T	A	13: 111,753,829	M1279L	possibly damaging	Het
Ncapg2	G	A	12: 116,427,756	R475Q	probably damaging	Het
Nlrp5	A	T	7: 23,417,916	N355I	probably damaging	Het
Olfr847	A	G	9: 19,375,143	V246A	probably benign	Het
Rgl3	A	G	9: 21,971,908	S705P	probably benign	Het
Rsbn1	A	G	3: 103,960,032	Y563C	probably damaging	Het
Sept9	A	G	11: 117,290,427	I18V	probably benign	Het
Sycp2	G	A	2: 178,395,894	P153S	probably damaging	Het
Tbc1d4	C	A	14: 101,608,318	R48L	possibly damaging	Het
Vmn1r195	G	A	13: 22,279,109	G250R	probably benign	Het
Vmn2r66	G	T	7: 85,006,846	P321T	probably benign	Het

Other mutations in Pdzd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01293:Pdzd8	APN	19	59299786	missense	probably damaging	1.00
IGL01321:Pdzd8	APN	19	59301529	missense	probably benign
IGL01865:Pdzd8	APN	19	59299645	missense	possibly damaging	0.92
IGL02044:Pdzd8	APN	19	59315292	missense	possibly damaging	0.85
IGL02119:Pdzd8	APN	19	59300490	missense	possibly damaging	0.95
IGL02186:Pdzd8	APN	19	59300628	missense	probably damaging	1.00
IGL02389:Pdzd8	APN	19	59301393	missense	probably benign	0.00
IGL02479:Pdzd8	APN	19	59299783	nonsense	probably null
IGL02713:Pdzd8	APN	19	59345458	missense	probably damaging	0.98
IGL02958:Pdzd8	APN	19	59300372	nonsense	probably null
IGL02966:Pdzd8	APN	19	59300859	missense	probably damaging	1.00
IGL03166:Pdzd8	APN	19	59300508	missense	probably damaging	1.00
citadel	UTSW	19	59299525	makesense	probably null
Eleventh_hour	UTSW	19	59305230	missense	probably damaging	1.00
keep	UTSW	19	59301351	nonsense	probably null
Stronghold	UTSW	19	59345352	nonsense	probably null
R0018:Pdzd8	UTSW	19	59300673	missense	probably damaging	1.00
R0038:Pdzd8	UTSW	19	59299596	missense	possibly damaging	0.54
R0196:Pdzd8	UTSW	19	59301131	missense	probably benign	0.00
R0233:Pdzd8	UTSW	19	59300379	missense	probably damaging	0.99
R0233:Pdzd8	UTSW	19	59300379	missense	probably damaging	0.99
R0418:Pdzd8	UTSW	19	59300929	missense	probably damaging	1.00
R0736:Pdzd8	UTSW	19	59344933	missense	probably damaging	0.99
R1456:Pdzd8	UTSW	19	59300472	missense	probably benign	0.01
R1709:Pdzd8	UTSW	19	59301339	missense	probably benign
R1965:Pdzd8	UTSW	19	59300122	missense	probably benign	0.37
R2155:Pdzd8	UTSW	19	59300421	missense	probably damaging	1.00
R3077:Pdzd8	UTSW	19	59305156	critical splice donor site	probably null
R3411:Pdzd8	UTSW	19	59345413	missense	probably damaging	1.00
R4345:Pdzd8	UTSW	19	59300128	missense	probably benign	0.00
R4354:Pdzd8	UTSW	19	59345481	missense	probably benign
R4504:Pdzd8	UTSW	19	59345448	missense	probably damaging	1.00
R4642:Pdzd8	UTSW	19	59305230	missense	probably damaging	1.00
R4705:Pdzd8	UTSW	19	59345311	missense	possibly damaging	0.80
R4773:Pdzd8	UTSW	19	59300860	missense	probably damaging	1.00
R4876:Pdzd8	UTSW	19	59300804	nonsense	probably null
R5176:Pdzd8	UTSW	19	59344957	missense	probably damaging	1.00
R5267:Pdzd8	UTSW	19	59301026	missense	probably damaging	1.00
R5707:Pdzd8	UTSW	19	59299625	missense	probably benign	0.00
R5766:Pdzd8	UTSW	19	59300540	missense	possibly damaging	0.65
R5903:Pdzd8	UTSW	19	59345286	missense	possibly damaging	0.58
R6036:Pdzd8	UTSW	19	59305209	missense	probably damaging	1.00
R6036:Pdzd8	UTSW	19	59305209	missense	probably damaging	1.00
R6238:Pdzd8	UTSW	19	59300562	missense	probably benign	0.05
R6360:Pdzd8	UTSW	19	59300983	missense	probably benign	0.10
R6674:Pdzd8	UTSW	19	59301369	missense	probably damaging	1.00
R6808:Pdzd8	UTSW	19	59299525	makesense	probably null
R6902:Pdzd8	UTSW	19	59301397	missense	possibly damaging	0.91
R7017:Pdzd8	UTSW	19	59345352	nonsense	probably null
R7088:Pdzd8	UTSW	19	59344957	missense	probably damaging	1.00
R7116:Pdzd8	UTSW	19	59299693	missense	probably damaging	1.00
R7158:Pdzd8	UTSW	19	59300157	missense	probably damaging	1.00
R7237:Pdzd8	UTSW	19	59345139	missense	probably damaging	1.00
R7251:Pdzd8	UTSW	19	59300645	missense	possibly damaging	0.96
R7314:Pdzd8	UTSW	19	59301351	nonsense	probably null
R7699:Pdzd8	UTSW	19	59344941	missense	probably damaging	1.00
R7751:Pdzd8	UTSW	19	59344776	missense	probably damaging	0.98
R7759:Pdzd8	UTSW	19	59299926	missense	probably damaging	1.00
R7784:Pdzd8	UTSW	19	59327863	missense	probably damaging	1.00
R7917:Pdzd8	UTSW	19	59345086	missense	probably damaging	0.96
R9364:Pdzd8	UTSW	19	59345142	missense	probably damaging	1.00
R9368:Pdzd8	UTSW	19	59300787	nonsense	probably null
R9406:Pdzd8	UTSW	19	59344813	missense

Predicted Primers

PCR Primer
(F):5'- TCCAGGTGGAAGCAAACTGC -3'
(R):5'- CTTCATCAAGACCATCCGGCTG -3'

Sequencing Primer
(F):5'- AAACTGCAGGCCAGGGTC -3'
(R):5'- TACAACGGCGGTTTCCA -3'

Posted On

2018-06-06