Incidental Mutation 'R6511:Rpl7'
ID519898
Institutional Source Beutler Lab
Gene Symbol Rpl7
Ensembl Gene ENSMUSG00000043716
Gene Nameribosomal protein L7
SynonymsSurf-3, Rpl7a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6511 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location16101295-16104662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 16103665 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 12 (A12S)
Ref Sequence ENSEMBL: ENSMUSP00000071616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027053] [ENSMUST00000058437]
Predicted Effect probably benign
Transcript: ENSMUST00000027053
SMART Domains Protein: ENSMUSP00000027053
Gene: ENSMUSG00000025921

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:KR 37 231 3.1e-8 PFAM
Pfam:adh_short 90 259 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058437
AA Change: A12S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071616
Gene: ENSMUSG00000043716
AA Change: A12S

DomainStartEndE-ValueType
Pfam:Ribosomal_L30_N 39 109 4.5e-31 PFAM
Pfam:Ribosomal_L30 112 162 1.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141217
Predicted Effect unknown
Transcript: ENSMUST00000149566
AA Change: A37S
SMART Domains Protein: ENSMUSP00000118695
Gene: ENSMUSG00000043716
AA Change: A37S

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Pfam:Ribosomal_L30_N 65 135 2.1e-31 PFAM
Pfam:Ribosomal_L30 138 188 3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151017
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L30P family of ribosomal proteins. It contains an N-terminal basic region-leucine zipper (BZIP)-like domain and the RNP consensus submotif RNP2. In vitro the BZIP-like domain mediates homodimerization and stable binding to DNA and RNA, with a preference for 28S rRNA and mRNA. The protein can inhibit cell-free translation of mRNAs, suggesting that it plays a regulatory role in the translation apparatus. It is located in the cytoplasm. The protein has been shown to be an autoantigen in patients with systemic autoimmune diseases, such as systemic lupus erythematosus. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Azin2 C A 4: 128,934,466 R316L probably damaging Het
Cep85l C T 10: 53,278,092 V702I probably benign Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Cyp4a30b A T 4: 115,456,708 D162V probably damaging Het
Exoc3l G T 8: 105,293,255 T346K probably benign Het
Gas8 T C 8: 123,524,157 V123A probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Mtif2 G T 11: 29,536,949 A320S possibly damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr1006 A G 2: 85,674,840 S104P possibly damaging Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Pip5k1c T C 10: 81,310,817 Y44H probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Sv2c C T 13: 96,048,525 V215I probably benign Het
Synpo2l T C 14: 20,662,450 E34G probably damaging Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp2 A T 11: 50,900,407 C270S probably damaging Het
Other mutations in Rpl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Rpl7 APN 1 16102583 missense possibly damaging 0.48
R0241:Rpl7 UTSW 1 16103222 missense possibly damaging 0.57
R1033:Rpl7 UTSW 1 16102504 missense probably benign 0.36
R1447:Rpl7 UTSW 1 16102597 missense probably benign 0.01
R1586:Rpl7 UTSW 1 16102583 missense probably benign 0.02
R4809:Rpl7 UTSW 1 16101965 intron probably benign
R8000:Rpl7 UTSW 1 16102725 missense probably benign 0.22
R8744:Rpl7 UTSW 1 16101889 missense probably benign 0.25
R8832:Rpl7 UTSW 1 16103261 missense possibly damaging 0.88
R8875:Rpl7 UTSW 1 16103529 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCTCAGTCCCAATAAGCTCC -3'
(R):5'- TGAAGGTTGTGGGCATGAAC -3'

Sequencing Primer
(F):5'- GTCCCAATAAGCTCCCTGGC -3'
(R):5'- TGAACGCTGCATCTCCAGTAGAG -3'
Posted On2018-06-06