Incidental Mutation 'R6511:Olfr1006'
ID 519902
Institutional Source Beutler Lab
Gene Symbol Olfr1006
Ensembl Gene ENSMUSG00000075211
Gene Name olfactory receptor 1006
Synonyms MOR213-4, GA_x6K02T2Q125-47154544-47153606
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6511 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 85673657-85678767 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85674840 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 104 (S104P)
Ref Sequence ENSEMBL: ENSMUSP00000149868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099917] [ENSMUST00000216084]
AlphaFold A2ALD2
Predicted Effect possibly damaging
Transcript: ENSMUST00000099917
AA Change: S104P

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097501
Gene: ENSMUSG00000075211
AA Change: S104P

DomainStartEndE-ValueType
Pfam:7tm_4 39 315 1.3e-51 PFAM
Pfam:7tm_1 49 298 3.6e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216084
AA Change: S104P

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216207
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Azin2 C A 4: 128,934,466 R316L probably damaging Het
Cep85l C T 10: 53,278,092 V702I probably benign Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Cyp4a30b A T 4: 115,456,708 D162V probably damaging Het
Exoc3l G T 8: 105,293,255 T346K probably benign Het
Gas8 T C 8: 123,524,157 V123A probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Mtif2 G T 11: 29,536,949 A320S possibly damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Pip5k1c T C 10: 81,310,817 Y44H probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Rpl7 C A 1: 16,103,665 A12S probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Sv2c C T 13: 96,048,525 V215I probably benign Het
Synpo2l T C 14: 20,662,450 E34G probably damaging Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp2 A T 11: 50,900,407 C270S probably damaging Het
Other mutations in Olfr1006
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Olfr1006 APN 2 85674497 missense probably damaging 1.00
IGL01520:Olfr1006 APN 2 85674357 missense probably benign 0.00
IGL01939:Olfr1006 APN 2 85674941 missense probably damaging 1.00
IGL02060:Olfr1006 APN 2 85674834 missense probably benign 0.34
IGL02171:Olfr1006 APN 2 85674941 missense probably damaging 1.00
IGL03058:Olfr1006 APN 2 85674681 missense probably benign 0.00
IGL03210:Olfr1006 APN 2 85674353 missense probably damaging 1.00
BB002:Olfr1006 UTSW 2 85674563 missense
BB012:Olfr1006 UTSW 2 85674563 missense
R0294:Olfr1006 UTSW 2 85674716 missense probably damaging 0.99
R1304:Olfr1006 UTSW 2 85674338 missense probably damaging 1.00
R1476:Olfr1006 UTSW 2 85674918 missense possibly damaging 0.92
R4757:Olfr1006 UTSW 2 85674320 missense probably damaging 1.00
R4793:Olfr1006 UTSW 2 85674498 missense probably damaging 1.00
R5804:Olfr1006 UTSW 2 85674338 missense probably damaging 1.00
R6146:Olfr1006 UTSW 2 85674594 nonsense probably null
R6896:Olfr1006 UTSW 2 85674933 missense probably damaging 0.97
R7075:Olfr1006 UTSW 2 85674824 missense
R7344:Olfr1006 UTSW 2 85674931 nonsense probably null
R7350:Olfr1006 UTSW 2 85674845 missense
R7925:Olfr1006 UTSW 2 85674563 missense
R8704:Olfr1006 UTSW 2 85674218 missense
Predicted Primers PCR Primer
(F):5'- TACCACAGAAAGTTAGCCGG -3'
(R):5'- GACATTGTCAGGGAACATGTTG -3'

Sequencing Primer
(F):5'- AAGGTGTTTGCAGTATGGGC -3'
(R):5'- AACATGTTGCTGGTTGTTTTAATCC -3'
Posted On 2018-06-06