Incidental Mutation 'R6511:Cyp4a30b'
ID519905
Institutional Source Beutler Lab
Gene Symbol Cyp4a30b
Ensembl Gene ENSMUSG00000084346
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 30b
SynonymsCyp4a30b-ps, OTTMUSG00000008626
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6511 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location115452604-115471062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115456708 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 162 (D162V)
Ref Sequence ENSEMBL: ENSMUSP00000140857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119958]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116278
Predicted Effect probably damaging
Transcript: ENSMUST00000119958
AA Change: D162V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140857
Gene: ENSMUSG00000084346
AA Change: D162V

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 52 503 1.4e-119 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Azin2 C A 4: 128,934,466 R316L probably damaging Het
Cep85l C T 10: 53,278,092 V702I probably benign Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Exoc3l G T 8: 105,293,255 T346K probably benign Het
Gas8 T C 8: 123,524,157 V123A probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Mtif2 G T 11: 29,536,949 A320S possibly damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr1006 A G 2: 85,674,840 S104P possibly damaging Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Pip5k1c T C 10: 81,310,817 Y44H probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Rpl7 C A 1: 16,103,665 A12S probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Sv2c C T 13: 96,048,525 V215I probably benign Het
Synpo2l T C 14: 20,662,450 E34G probably damaging Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp2 A T 11: 50,900,407 C270S probably damaging Het
Other mutations in Cyp4a30b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03184:Cyp4a30b APN 4 115459019 missense probably damaging 1.00
IGL03233:Cyp4a30b APN 4 115458970 missense probably benign 0.08
R1394:Cyp4a30b UTSW 4 115470892 critical splice acceptor site probably null
R2870:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2870:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2871:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2871:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2872:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2872:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2873:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R3818:Cyp4a30b UTSW 4 115459009 missense probably damaging 1.00
R4052:Cyp4a30b UTSW 4 115454342 missense probably benign 0.00
R4684:Cyp4a30b UTSW 4 115455003 missense probably damaging 1.00
R5558:Cyp4a30b UTSW 4 115458866 missense probably damaging 1.00
R5997:Cyp4a30b UTSW 4 115459391 nonsense probably null
R6242:Cyp4a30b UTSW 4 115454390 missense possibly damaging 0.48
R6759:Cyp4a30b UTSW 4 115461374 missense probably benign 0.02
R7285:Cyp4a30b UTSW 4 115456651 missense probably damaging 1.00
R8154:Cyp4a30b UTSW 4 115458296 missense probably benign 0.00
R8314:Cyp4a30b UTSW 4 115458338 missense probably benign 0.00
R8439:Cyp4a30b UTSW 4 115457775 missense probably benign 0.44
R8681:Cyp4a30b UTSW 4 115457745 missense possibly damaging 0.93
R8735:Cyp4a30b UTSW 4 115452779 nonsense probably null
R8816:Cyp4a30b UTSW 4 115452637 missense probably benign 0.23
R8845:Cyp4a30b UTSW 4 115458296 missense probably benign 0.04
Z1176:Cyp4a30b UTSW 4 115470959 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AGAAATTCTGCCTTCCTCAGAG -3'
(R):5'- TCATATGCACCTTGAGGGAGG -3'

Sequencing Primer
(F):5'- GTTCCTTCAAAATCATCCAAAGGGTC -3'
(R):5'- CACCTTGAGGGAGGAAGGATAG -3'
Posted On2018-06-06