Incidental Mutation 'R6511:Azin2'
ID519906
Institutional Source Beutler Lab
Gene Symbol Azin2
Ensembl Gene ENSMUSG00000028789
Gene Nameantizyme inhibitor 2
SynonymsAZIN2, Odcp, 4933429I20Rik, Adc
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R6511 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location128930233-128962442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 128934466 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 316 (R316L)
Ref Sequence ENSEMBL: ENSMUSP00000114086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030581] [ENSMUST00000106068] [ENSMUST00000119354]
Predicted Effect probably benign
Transcript: ENSMUST00000030581
AA Change: R411L

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030581
Gene: ENSMUSG00000028789
AA Change: R411L

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 45 283 1.9e-69 PFAM
Pfam:Orn_DAP_Arg_deC 286 407 1.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106068
AA Change: R411L

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101683
Gene: ENSMUSG00000028789
AA Change: R411L

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 45 283 6.7e-73 PFAM
Pfam:Orn_DAP_Arg_deC 287 406 1.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119354
AA Change: R316L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114086
Gene: ENSMUSG00000028789
AA Change: R316L

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 1 188 4.2e-54 PFAM
Pfam:Orn_DAP_Arg_deC 191 312 4.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154515
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 2, the second member of this gene family. Like antizyme inhibitor 1, antizyme inhibitor 2 interacts with all 3 antizymes and stimulates ODC activity and polyamine uptake. However, unlike antizyme inhibitor 1, which is ubiquitously expressed and localized in the nucleus and cytoplasm, antizyme inhibitor 2 is predominantly expressed in the brain and testis and localized in the endoplasmic reticulum-golgi intermediate compartment. Recent studies indicate that antizyme inhibitor 2 is also expressed in specific cell types in ovaries, adrenal glands and pancreas, and in mast cells. The exact function of this gene is not known, however, available data suggest its role in cell growth, spermiogenesis, vesicular trafficking and secretion. There has been confusion in literature and databases over the nomenclature of this gene, stemming from an earlier report that a human cDNA clone (identical to ODCp/AZIN2) had arginine decarboxylase (ADC) activity (PMID:14738999). Subsequent studies in human and mouse showed that antizyme inhibitor 2 was devoid of arginine decarboxylase activity (PMID:19956990). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased circulating insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Cep85l C T 10: 53,278,092 V702I probably benign Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Cyp4a30b A T 4: 115,456,708 D162V probably damaging Het
Exoc3l G T 8: 105,293,255 T346K probably benign Het
Gas8 T C 8: 123,524,157 V123A probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Mtif2 G T 11: 29,536,949 A320S possibly damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr1006 A G 2: 85,674,840 S104P possibly damaging Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Pip5k1c T C 10: 81,310,817 Y44H probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Rpl7 C A 1: 16,103,665 A12S probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Sv2c C T 13: 96,048,525 V215I probably benign Het
Synpo2l T C 14: 20,662,450 E34G probably damaging Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp2 A T 11: 50,900,407 C270S probably damaging Het
Other mutations in Azin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Azin2 APN 4 128950666 missense probably damaging 1.00
IGL02040:Azin2 APN 4 128950658 missense possibly damaging 0.78
IGL03349:Azin2 APN 4 128946114 nonsense probably null
R0118:Azin2 UTSW 4 128949637 missense probably damaging 0.97
R1215:Azin2 UTSW 4 128949696 missense probably damaging 0.96
R1940:Azin2 UTSW 4 128950784 splice site probably null
R2939:Azin2 UTSW 4 128934604 missense probably benign 0.44
R4899:Azin2 UTSW 4 128934653 missense probably benign 0.43
R5836:Azin2 UTSW 4 128948877 missense probably damaging 1.00
T0722:Azin2 UTSW 4 128946134 missense probably benign 0.00
T0975:Azin2 UTSW 4 128946134 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCCCATGCAGTCACAAGC -3'
(R):5'- CGGATCAACCACTGTACAGC -3'

Sequencing Primer
(F):5'- TCCACTGAGGGACGCAC -3'
(R):5'- TGTACAGCAGCAGCCTGTG -3'
Posted On2018-06-06