Mutagenetix > Incidental Mutation

Incidental Mutation 'R6511:Azin2'

519906

Institutional Source

Beutler Lab

Gene Symbol

Azin2

Ensembl Gene

ENSMUSG00000028789

Gene Name

antizyme inhibitor 2

Synonyms

Adc, Odcp, 4933429I20Rik, AZIN2

MMRRC Submission

044639-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.300) question?

Stock #

R6511 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128824026-128856235 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 128828259 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 316 (R316L)

Ref Sequence

ENSEMBL: ENSMUSP00000114086 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030581] [ENSMUST00000106068] [ENSMUST00000119354]

AlphaFold

Q8BVM4

Predicted Effect

probably benign
Transcript: ENSMUST00000030581
AA Change: R411L

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000030581
Gene: ENSMUSG00000028789
AA Change: R411L

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	45	283	1.9e-69	PFAM
Pfam:Orn_DAP_Arg_deC	286	407	1.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106068
AA Change: R411L

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000101683
Gene: ENSMUSG00000028789
AA Change: R411L

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	45	283	6.7e-73	PFAM
Pfam:Orn_DAP_Arg_deC	287	406	1.9e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119354
AA Change: R316L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114086
Gene: ENSMUSG00000028789
AA Change: R316L

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	1	188	4.2e-54	PFAM
Pfam:Orn_DAP_Arg_deC	191	312	4.3e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154515

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 2, the second member of this gene family. Like antizyme inhibitor 1, antizyme inhibitor 2 interacts with all 3 antizymes and stimulates ODC activity and polyamine uptake. However, unlike antizyme inhibitor 1, which is ubiquitously expressed and localized in the nucleus and cytoplasm, antizyme inhibitor 2 is predominantly expressed in the brain and testis and localized in the endoplasmic reticulum-golgi intermediate compartment. Recent studies indicate that antizyme inhibitor 2 is also expressed in specific cell types in ovaries, adrenal glands and pancreas, and in mast cells. The exact function of this gene is not known, however, available data suggest its role in cell growth, spermiogenesis, vesicular trafficking and secretion. There has been confusion in literature and databases over the nomenclature of this gene, stemming from an earlier report that a human cDNA clone (identical to ODCp/AZIN2) had arginine decarboxylase (ADC) activity (PMID:14738999). Subsequent studies in human and mouse showed that antizyme inhibitor 2 was devoid of arginine decarboxylase activity (PMID:19956990). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased circulating insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,195,344 (GRCm39)	H718Y	probably damaging	Het
Abcc8	G	A	7: 45,800,285 (GRCm39)	T499I	possibly damaging	Het
Cep85l	C	T	10: 53,154,188 (GRCm39)	V702I	probably benign	Het
Cfap69	A	T	5: 5,667,220 (GRCm39)	C442S	probably damaging	Het
Commd3	G	A	2: 18,679,650 (GRCm39)	G148R	probably benign	Het
Cyfip2	T	C	11: 46,087,135 (GRCm39)	T1252A	probably benign	Het
Cyp4a30b	A	T	4: 115,313,905 (GRCm39)	D162V	probably damaging	Het
Exoc3l	G	T	8: 106,019,887 (GRCm39)	T346K	probably benign	Het
Gas8	T	C	8: 124,250,896 (GRCm39)	V123A	probably benign	Het
Hmcn2	T	G	2: 31,246,354 (GRCm39)	D774E	possibly damaging	Het
Itga1	G	T	13: 115,129,037 (GRCm39)	S540R	probably damaging	Het
Itpr2	T	C	6: 146,231,225 (GRCm39)	N1145S	probably damaging	Het
Kcnc2	C	T	10: 112,297,972 (GRCm39)		probably benign	Het
Lrp5	G	A	19: 3,702,296 (GRCm39)	R174W	probably damaging	Het
Lrrn4	T	G	2: 132,712,246 (GRCm39)	S526R	probably benign	Het
Map3k6	G	A	4: 132,975,389 (GRCm39)	R708H	probably damaging	Het
Mefv	T	C	16: 3,533,810 (GRCm39)	T154A	probably benign	Het
Mrtfb	T	A	16: 13,197,714 (GRCm39)	S66R	probably damaging	Het
Mtif2	G	T	11: 29,486,949 (GRCm39)	A320S	possibly damaging	Het
Nos2	A	G	11: 78,846,290 (GRCm39)		probably null	Het
Or4k15b	A	G	14: 50,272,266 (GRCm39)	L198P	probably damaging	Het
Or9g4	A	G	2: 85,505,184 (GRCm39)	S104P	possibly damaging	Het
Pip5k1c	T	C	10: 81,146,651 (GRCm39)	Y44H	probably damaging	Het
Ppp1r13b	T	C	12: 111,798,001 (GRCm39)	E972G	probably damaging	Het
Prdm12	T	C	2: 31,530,321 (GRCm39)	S71P	probably damaging	Het
Prkag2	G	T	5: 25,305,286 (GRCm39)		probably benign	Het
Ptprb	T	C	10: 116,182,725 (GRCm39)	L1467P	probably damaging	Het
Rnf43	G	A	11: 87,622,989 (GRCm39)	V697I	probably benign	Het
Rpl7	C	A	1: 16,173,889 (GRCm39)	A12S	probably benign	Het
Slc25a54	T	G	3: 109,001,572 (GRCm39)	I120S	possibly damaging	Het
Slc41a2	T	C	10: 83,119,652 (GRCm39)	H370R	probably damaging	Het
Speer1d	A	G	5: 11,307,275 (GRCm39)	Y51C	probably benign	Het
Sv2c	C	T	13: 96,185,033 (GRCm39)	V215I	probably benign	Het
Synpo2l	T	C	14: 20,712,518 (GRCm39)	E34G	probably damaging	Het
Tubgcp5	T	A	7: 55,467,140 (GRCm39)	C703*	probably null	Het
Vmn1r158	T	C	7: 22,490,116 (GRCm39)	K31R	probably benign	Het
Vmn2r106	C	T	17: 20,488,725 (GRCm39)	C558Y	probably damaging	Het
Zfp2	A	T	11: 50,791,234 (GRCm39)	C270S	probably damaging	Het

Other mutations in Azin2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Azin2	APN	4	128,844,459 (GRCm39)	missense	probably damaging	1.00
IGL02040:Azin2	APN	4	128,844,451 (GRCm39)	missense	possibly damaging	0.78
IGL03349:Azin2	APN	4	128,839,907 (GRCm39)	nonsense	probably null
R0118:Azin2	UTSW	4	128,843,430 (GRCm39)	missense	probably damaging	0.97
R1215:Azin2	UTSW	4	128,843,489 (GRCm39)	missense	probably damaging	0.96
R1940:Azin2	UTSW	4	128,844,577 (GRCm39)	splice site	probably null
R2939:Azin2	UTSW	4	128,828,397 (GRCm39)	missense	probably benign	0.44
R4899:Azin2	UTSW	4	128,828,446 (GRCm39)	missense	probably benign	0.43
R5836:Azin2	UTSW	4	128,842,670 (GRCm39)	missense	probably damaging	1.00
R9059:Azin2	UTSW	4	128,828,440 (GRCm39)	missense	probably benign	0.03
R9209:Azin2	UTSW	4	128,841,341 (GRCm39)	missense	probably damaging	0.99
R9266:Azin2	UTSW	4	128,856,230 (GRCm39)	unclassified	probably benign
R9595:Azin2	UTSW	4	128,853,617 (GRCm39)	missense	probably benign	0.03
T0722:Azin2	UTSW	4	128,839,927 (GRCm39)	missense	probably benign	0.00
T0975:Azin2	UTSW	4	128,839,927 (GRCm39)	missense	probably benign	0.00
Z1176:Azin2	UTSW	4	128,828,452 (GRCm39)	missense	possibly damaging	0.54

Predicted Primers

PCR Primer
(F):5'- TTCCCCATGCAGTCACAAGC -3'
(R):5'- CGGATCAACCACTGTACAGC -3'

Sequencing Primer
(F):5'- TCCACTGAGGGACGCAC -3'
(R):5'- TGTACAGCAGCAGCCTGTG -3'

Posted On

2018-06-06