Mutagenetix > Incidental Mutation

Incidental Mutation 'R6511:Map3k6'

519908

Institutional Source

Beutler Lab

Gene Symbol

Map3k6

Ensembl Gene

ENSMUSG00000028862

Gene Name

mitogen-activated protein kinase kinase kinase 6

Synonyms

Ask2, MAPKKK6, MEKK6

MMRRC Submission

044639-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.477) question?

Stock #

R6511 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

133240818-133252929 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 133248078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 708 (R708H)

Ref Sequence

ENSEMBL: ENSMUSP00000030677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030677]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030677
AA Change: R708H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: R708H

Domain	Start	End	E-Value	Type
low complexity region	98	109	N/A	INTRINSIC
Pfam:DUF4071	130	508	2.3e-150	PFAM
S_TKc	649	907	3.49e-87	SMART
low complexity region	925	940	N/A	INTRINSIC
low complexity region	947	960	N/A	INTRINSIC
low complexity region	975	990	N/A	INTRINSIC
low complexity region	1130	1146	N/A	INTRINSIC
coiled coil region	1164	1195	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123612

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127681

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134895

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,376,594	H718Y	probably damaging	Het
Abcc8	G	A	7: 46,150,861	T499I	possibly damaging	Het
Azin2	C	A	4: 128,934,466	R316L	probably damaging	Het
Cep85l	C	T	10: 53,278,092	V702I	probably benign	Het
Cfap69	A	T	5: 5,617,220	C442S	probably damaging	Het
Commd3	G	A	2: 18,674,839	G148R	probably benign	Het
Cyfip2	T	C	11: 46,196,308	T1252A	probably benign	Het
Cyp4a30b	A	T	4: 115,456,708	D162V	probably damaging	Het
Exoc3l	G	T	8: 105,293,255	T346K	probably benign	Het
Gas8	T	C	8: 123,524,157	V123A	probably benign	Het
Gm8890	A	G	5: 11,257,308	Y51C	probably benign	Het
Hmcn2	T	G	2: 31,356,342	D774E	possibly damaging	Het
Itga1	G	T	13: 114,992,501	S540R	probably damaging	Het
Itpr2	T	C	6: 146,329,727	N1145S	probably damaging	Het
Kcnc2	C	T	10: 112,462,067		probably benign	Het
Lrp5	G	A	19: 3,652,296	R174W	probably damaging	Het
Lrrn4	T	G	2: 132,870,326	S526R	probably benign	Het
Mefv	T	C	16: 3,715,946	T154A	probably benign	Het
Mkl2	T	A	16: 13,379,850	S66R	probably damaging	Het
Mtif2	G	T	11: 29,536,949	A320S	possibly damaging	Het
Nos2	A	G	11: 78,955,464		probably null	Het
Olfr1006	A	G	2: 85,674,840	S104P	possibly damaging	Het
Olfr725	A	G	14: 50,034,809	L198P	probably damaging	Het
Pip5k1c	T	C	10: 81,310,817	Y44H	probably damaging	Het
Ppp1r13b	T	C	12: 111,831,567	E972G	probably damaging	Het
Prdm12	T	C	2: 31,640,309	S71P	probably damaging	Het
Prkag2	G	T	5: 25,100,288		probably benign	Het
Ptprb	T	C	10: 116,346,820	L1467P	probably damaging	Het
Rnf43	G	A	11: 87,732,163	V697I	probably benign	Het
Rpl7	C	A	1: 16,103,665	A12S	probably benign	Het
Slc25a54	T	G	3: 109,094,256	I120S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,788	H370R	probably damaging	Het
Sv2c	C	T	13: 96,048,525	V215I	probably benign	Het
Synpo2l	T	C	14: 20,662,450	E34G	probably damaging	Het
Tubgcp5	T	A	7: 55,817,392	C703*	probably null	Het
Vmn1r158	T	C	7: 22,790,691	K31R	probably benign	Het
Vmn2r106	C	T	17: 20,268,463	C558Y	probably damaging	Het
Zfp2	A	T	11: 50,900,407	C270S	probably damaging	Het

Other mutations in Map3k6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Map3k6	APN	4	133243044	splice site	probably benign
IGL01060:Map3k6	APN	4	133247302	splice site	probably null
IGL01116:Map3k6	APN	4	133247128	missense	probably damaging	0.98
IGL01341:Map3k6	APN	4	133248060	missense	possibly damaging	0.67
IGL02383:Map3k6	APN	4	133246621	splice site	probably null
IGL03090:Map3k6	APN	4	133243366	missense	probably benign	0.05
IGL03096:Map3k6	APN	4	133251345	nonsense	probably null
IGL03149:Map3k6	APN	4	133249688	missense	probably damaging	1.00
R0110:Map3k6	UTSW	4	133243794	missense	probably damaging	1.00
R0142:Map3k6	UTSW	4	133250946	missense	probably benign
R0189:Map3k6	UTSW	4	133246941	missense	possibly damaging	0.46
R0368:Map3k6	UTSW	4	133252659	missense	probably benign	0.23
R0417:Map3k6	UTSW	4	133248082	nonsense	probably null
R0595:Map3k6	UTSW	4	133241263	missense	probably damaging	0.98
R0597:Map3k6	UTSW	4	133245552	missense	possibly damaging	0.46
R0699:Map3k6	UTSW	4	133248126	missense	probably damaging	1.00
R1099:Map3k6	UTSW	4	133247128	missense	probably damaging	1.00
R1113:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1308:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1607:Map3k6	UTSW	4	133252473	missense	probably damaging	1.00
R2217:Map3k6	UTSW	4	133246672	missense	possibly damaging	0.46
R3734:Map3k6	UTSW	4	133248396	missense	possibly damaging	0.79
R3735:Map3k6	UTSW	4	133246372	missense	probably benign	0.21
R3743:Map3k6	UTSW	4	133245073	missense	probably benign	0.26
R4244:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4245:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4465:Map3k6	UTSW	4	133246333	missense	possibly damaging	0.66
R4482:Map3k6	UTSW	4	133243399	missense	probably benign	0.00
R4827:Map3k6	UTSW	4	133248849	missense	possibly damaging	0.92
R5092:Map3k6	UTSW	4	133251743	missense	probably benign	0.00
R5110:Map3k6	UTSW	4	133247548	intron	probably benign
R5258:Map3k6	UTSW	4	133247642	missense	possibly damaging	0.81
R5369:Map3k6	UTSW	4	133247681	missense	probably damaging	0.99
R5642:Map3k6	UTSW	4	133245544	missense	probably damaging	0.99
R5648:Map3k6	UTSW	4	133243335	missense	probably benign	0.25
R6102:Map3k6	UTSW	4	133247131	critical splice donor site	probably null
R6144:Map3k6	UTSW	4	133245675	missense	probably damaging	1.00
R6476:Map3k6	UTSW	4	133250086	missense	probably damaging	0.98
R6522:Map3k6	UTSW	4	133250024	missense	possibly damaging	0.65
R6706:Map3k6	UTSW	4	133250939	nonsense	probably null
R6874:Map3k6	UTSW	4	133250656	missense	probably benign	0.02
R7069:Map3k6	UTSW	4	133251712	missense	probably benign	0.01
R7216:Map3k6	UTSW	4	133246900	missense	probably damaging	0.99
R7417:Map3k6	UTSW	4	133248396	missense	probably benign	0.43
R7538:Map3k6	UTSW	4	133251927	missense	probably benign
R7569:Map3k6	UTSW	4	133250077	missense	probably benign	0.04
R8003:Map3k6	UTSW	4	133248882	missense	probably benign	0.05
R8407:Map3k6	UTSW	4	133247593	missense	possibly damaging	0.95
R8817:Map3k6	UTSW	4	133246760	missense	probably benign	0.00
R8939:Map3k6	UTSW	4	133252643	unclassified	probably benign
R9285:Map3k6	UTSW	4	133245559	missense	probably damaging	1.00
R9308:Map3k6	UTSW	4	133243411	missense	probably damaging	1.00
R9400:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9401:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9573:Map3k6	UTSW	4	133252463	missense	probably damaging	0.99
R9677:Map3k6	UTSW	4	133241116	missense	probably benign	0.04
R9682:Map3k6	UTSW	4	133248108	missense	possibly damaging	0.61
R9745:Map3k6	UTSW	4	133252472	missense	probably damaging	1.00
R9751:Map3k6	UTSW	4	133251857	critical splice acceptor site	probably null
Z1088:Map3k6	UTSW	4	133245066	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGGCATGGAAAGAGCTCTTTAG -3'
(R):5'- CGCACGCTAGAGTTCATTTC -3'

Sequencing Primer
(F):5'- AAAGAGCTCTTTAGTGGCTGGAC -3'
(R):5'- GCTAGAGTTCATTTCCCCTCAGG -3'

Posted On

2018-06-06