Mutagenetix > Incidental Mutation

Incidental Mutation 'R6511:Tubgcp5'

519915

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp5

Ensembl Gene

ENSMUSG00000033790

Gene Name

tubulin, gamma complex associated protein 5

Synonyms

B130010C12Rik, GCP5

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R6511 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55794154-55831677 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 55817392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 703 (C703*)

Ref Sequence

ENSEMBL: ENSMUSP00000032627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191]

AlphaFold

Q8BKN5

Predicted Effect

probably null
Transcript: ENSMUST00000032627
AA Change: C703*

SMART Domains

Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: C703*

Domain	Start	End	E-Value	Type
low complexity region	109	124	N/A	INTRINSIC
Pfam:Spc97_Spc98	273	942	1.2e-126	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205311

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205718

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205779

Predicted Effect

probably benign
Transcript: ENSMUST00000205796

Predicted Effect

probably benign
Transcript: ENSMUST00000206191

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206789

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

100% (39/39)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,376,594	H718Y	probably damaging	Het
Abcc8	G	A	7: 46,150,861	T499I	possibly damaging	Het
Azin2	C	A	4: 128,934,466	R316L	probably damaging	Het
Cep85l	C	T	10: 53,278,092	V702I	probably benign	Het
Cfap69	A	T	5: 5,617,220	C442S	probably damaging	Het
Commd3	G	A	2: 18,674,839	G148R	probably benign	Het
Cyfip2	T	C	11: 46,196,308	T1252A	probably benign	Het
Cyp4a30b	A	T	4: 115,456,708	D162V	probably damaging	Het
Exoc3l	G	T	8: 105,293,255	T346K	probably benign	Het
Gas8	T	C	8: 123,524,157	V123A	probably benign	Het
Gm8890	A	G	5: 11,257,308	Y51C	probably benign	Het
Hmcn2	T	G	2: 31,356,342	D774E	possibly damaging	Het
Itga1	G	T	13: 114,992,501	S540R	probably damaging	Het
Itpr2	T	C	6: 146,329,727	N1145S	probably damaging	Het
Kcnc2	C	T	10: 112,462,067		probably benign	Het
Lrp5	G	A	19: 3,652,296	R174W	probably damaging	Het
Lrrn4	T	G	2: 132,870,326	S526R	probably benign	Het
Map3k6	G	A	4: 133,248,078	R708H	probably damaging	Het
Mefv	T	C	16: 3,715,946	T154A	probably benign	Het
Mkl2	T	A	16: 13,379,850	S66R	probably damaging	Het
Mtif2	G	T	11: 29,536,949	A320S	possibly damaging	Het
Nos2	A	G	11: 78,955,464		probably null	Het
Olfr1006	A	G	2: 85,674,840	S104P	possibly damaging	Het
Olfr725	A	G	14: 50,034,809	L198P	probably damaging	Het
Pip5k1c	T	C	10: 81,310,817	Y44H	probably damaging	Het
Ppp1r13b	T	C	12: 111,831,567	E972G	probably damaging	Het
Prdm12	T	C	2: 31,640,309	S71P	probably damaging	Het
Prkag2	G	T	5: 25,100,288		probably benign	Het
Ptprb	T	C	10: 116,346,820	L1467P	probably damaging	Het
Rnf43	G	A	11: 87,732,163	V697I	probably benign	Het
Rpl7	C	A	1: 16,103,665	A12S	probably benign	Het
Slc25a54	T	G	3: 109,094,256	I120S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,788	H370R	probably damaging	Het
Sv2c	C	T	13: 96,048,525	V215I	probably benign	Het
Synpo2l	T	C	14: 20,662,450	E34G	probably damaging	Het
Vmn1r158	T	C	7: 22,790,691	K31R	probably benign	Het
Vmn2r106	C	T	17: 20,268,463	C558Y	probably damaging	Het
Zfp2	A	T	11: 50,900,407	C270S	probably damaging	Het

Other mutations in Tubgcp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Tubgcp5	APN	7	55806595	missense	possibly damaging	0.91
IGL01291:Tubgcp5	APN	7	55808529	missense	possibly damaging	0.83
IGL01343:Tubgcp5	APN	7	55796031	splice site	probably benign
IGL01597:Tubgcp5	APN	7	55806832	splice site	probably benign
IGL01688:Tubgcp5	APN	7	55815018	missense	possibly damaging	0.92
IGL01843:Tubgcp5	APN	7	55799473	missense	probably benign	0.02
IGL01950:Tubgcp5	APN	7	55806088	missense	possibly damaging	0.93
IGL01957:Tubgcp5	APN	7	55818757	missense	probably damaging	1.00
IGL02902:Tubgcp5	APN	7	55806607	nonsense	probably null
IGL03105:Tubgcp5	APN	7	55825581	missense	probably damaging	1.00
ANU05:Tubgcp5	UTSW	7	55808529	missense	possibly damaging	0.83
R0078:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R0322:Tubgcp5	UTSW	7	55814978	missense	probably damaging	0.98
R0362:Tubgcp5	UTSW	7	55800684	missense	probably damaging	1.00
R0449:Tubgcp5	UTSW	7	55823567	missense	probably benign
R0488:Tubgcp5	UTSW	7	55829338	missense	probably damaging	0.96
R0853:Tubgcp5	UTSW	7	55814851	splice site	probably benign
R0885:Tubgcp5	UTSW	7	55806055	nonsense	probably null
R1483:Tubgcp5	UTSW	7	55825707	critical splice donor site	probably null
R1746:Tubgcp5	UTSW	7	55808537	missense	probably benign	0.05
R1766:Tubgcp5	UTSW	7	55815020	missense	probably benign	0.15
R2148:Tubgcp5	UTSW	7	55799511	missense	probably damaging	1.00
R2229:Tubgcp5	UTSW	7	55830881	missense	probably damaging	1.00
R3766:Tubgcp5	UTSW	7	55830866	missense	probably damaging	0.98
R4154:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R4838:Tubgcp5	UTSW	7	55794185	unclassified	probably benign
R4948:Tubgcp5	UTSW	7	55806123	missense	probably benign	0.00
R5110:Tubgcp5	UTSW	7	55808637	missense	probably damaging	0.96
R5347:Tubgcp5	UTSW	7	55823685	missense	probably damaging	1.00
R5417:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R5574:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R5758:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R5957:Tubgcp5	UTSW	7	55814962	missense	probably benign	0.03
R6014:Tubgcp5	UTSW	7	55823609	missense	probably benign
R6141:Tubgcp5	UTSW	7	55806778	missense	probably benign	0.30
R6289:Tubgcp5	UTSW	7	55795923	missense	probably benign	0.05
R6563:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R6574:Tubgcp5	UTSW	7	55823583	missense	probably benign
R6596:Tubgcp5	UTSW	7	55806634	missense	probably benign	0.38
R7016:Tubgcp5	UTSW	7	55794229	missense	possibly damaging	0.76
R7038:Tubgcp5	UTSW	7	55805366	missense	probably damaging	0.99
R7075:Tubgcp5	UTSW	7	55829407	missense	probably benign	0.04
R7083:Tubgcp5	UTSW	7	55800695	nonsense	probably null
R7213:Tubgcp5	UTSW	7	55806112	missense	probably damaging	0.97
R7284:Tubgcp5	UTSW	7	55823567	missense	probably benign
R7600:Tubgcp5	UTSW	7	55808513	missense	probably benign
R7813:Tubgcp5	UTSW	7	55800696	missense	possibly damaging	0.49
R7920:Tubgcp5	UTSW	7	55816562	missense	probably benign	0.00
R7948:Tubgcp5	UTSW	7	55794248	missense	probably benign	0.01
R8438:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R8499:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R9087:Tubgcp5	UTSW	7	55817358	missense	probably damaging	1.00
R9211:Tubgcp5	UTSW	7	55806583	missense	probably benign	0.05
R9269:Tubgcp5	UTSW	7	55795945	missense	possibly damaging	0.94
R9329:Tubgcp5	UTSW	7	55829433	critical splice donor site	probably null
R9355:Tubgcp5	UTSW	7	55817429	critical splice donor site	probably null
R9498:Tubgcp5	UTSW	7	55813485	missense	possibly damaging	0.46
R9687:Tubgcp5	UTSW	7	55825579	critical splice acceptor site	probably null
Z1088:Tubgcp5	UTSW	7	55815101	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGATTGATCATCTGAAGCGAAAGG -3'
(R):5'- CACTGTGCATGTTCTGAGCG -3'

Sequencing Primer
(F):5'- AAAAATGGGAGTCTAGGTTTTGC -3'
(R):5'- GGCTGTTCTTGAACTCAGAAATCCAC -3'

Posted On

2018-06-06