Incidental Mutation 'R6511:Exoc3l'
ID519916
Institutional Source Beutler Lab
Gene Symbol Exoc3l
Ensembl Gene ENSMUSG00000043251
Gene Nameexocyst complex component 3-like
SynonymsC730015A04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R6511 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105289924-105296101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105293255 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 346 (T346K)
Ref Sequence ENSEMBL: ENSMUSP00000053766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014981] [ENSMUST00000015003] [ENSMUST00000057855] [ENSMUST00000171788] [ENSMUST00000212219] [ENSMUST00000212777] [ENSMUST00000212922]
Predicted Effect probably benign
Transcript: ENSMUST00000014981
SMART Domains Protein: ENSMUSP00000014981
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000015003
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057855
AA Change: T346K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251
AA Change: T346K

DomainStartEndE-ValueType
Pfam:Sec6 189 722 5.4e-116 PFAM
low complexity region 723 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171788
SMART Domains Protein: ENSMUSP00000128530
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212215
Predicted Effect probably benign
Transcript: ENSMUST00000212219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212529
Predicted Effect probably benign
Transcript: ENSMUST00000212777
Predicted Effect probably benign
Transcript: ENSMUST00000212922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212974
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Azin2 C A 4: 128,934,466 R316L probably damaging Het
Cep85l C T 10: 53,278,092 V702I probably benign Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Cyp4a30b A T 4: 115,456,708 D162V probably damaging Het
Gas8 T C 8: 123,524,157 V123A probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Mtif2 G T 11: 29,536,949 A320S possibly damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr1006 A G 2: 85,674,840 S104P possibly damaging Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Pip5k1c T C 10: 81,310,817 Y44H probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Rpl7 C A 1: 16,103,665 A12S probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Sv2c C T 13: 96,048,525 V215I probably benign Het
Synpo2l T C 14: 20,662,450 E34G probably damaging Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp2 A T 11: 50,900,407 C270S probably damaging Het
Other mutations in Exoc3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Exoc3l APN 8 105290498 missense probably benign 0.25
IGL01731:Exoc3l APN 8 105292955 missense probably benign 0.16
IGL02364:Exoc3l APN 8 105290577 missense possibly damaging 0.71
IGL02413:Exoc3l APN 8 105292438 missense probably damaging 1.00
IGL02512:Exoc3l APN 8 105290483 missense probably damaging 1.00
IGL02810:Exoc3l APN 8 105295348 missense probably damaging 1.00
R0045:Exoc3l UTSW 8 105293685 missense probably damaging 1.00
R0045:Exoc3l UTSW 8 105293685 missense probably damaging 1.00
R0183:Exoc3l UTSW 8 105295300 missense probably damaging 1.00
R0302:Exoc3l UTSW 8 105293543 missense probably benign 0.01
R1660:Exoc3l UTSW 8 105293060 critical splice donor site probably null
R1699:Exoc3l UTSW 8 105295013 missense probably benign 0.34
R1826:Exoc3l UTSW 8 105293618 missense probably damaging 0.97
R2275:Exoc3l UTSW 8 105290447 critical splice donor site probably null
R3928:Exoc3l UTSW 8 105290917 unclassified probably benign
R3938:Exoc3l UTSW 8 105293405 missense probably damaging 1.00
R4261:Exoc3l UTSW 8 105290967 missense probably damaging 0.98
R4273:Exoc3l UTSW 8 105289961 makesense probably null
R5518:Exoc3l UTSW 8 105293163 missense probably benign 0.27
R6471:Exoc3l UTSW 8 105290534 missense probably damaging 1.00
R6631:Exoc3l UTSW 8 105295361 missense probably damaging 1.00
R6694:Exoc3l UTSW 8 105290490 missense probably benign 0.15
R6843:Exoc3l UTSW 8 105290097 missense probably benign 0.00
R7310:Exoc3l UTSW 8 105293708 missense probably damaging 1.00
R7387:Exoc3l UTSW 8 105294973 missense probably damaging 1.00
R7442:Exoc3l UTSW 8 105292926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGTCACCTGAACCTGAGC -3'
(R):5'- AGACTGAGCGCACAATCCTG -3'

Sequencing Primer
(F):5'- TGAACCTGAGCCACAAAGG -3'
(R):5'- ATGTCTTCGGGCGCTACAG -3'
Posted On2018-06-06