Mutagenetix > Incidental Mutation

Incidental Mutation 'R6511:Exoc3l'

519916

Institutional Source

Beutler Lab

Gene Symbol

Exoc3l

Ensembl Gene

ENSMUSG00000043251

Gene Name

exocyst complex component 3-like

Synonyms

C730015A04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R6511 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105289924-105296101 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 105293255 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 346 (T346K)

Ref Sequence

ENSEMBL: ENSMUSP00000053766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014981] [ENSMUST00000015003] [ENSMUST00000057855] [ENSMUST00000171788] [ENSMUST00000212219] [ENSMUST00000212777] [ENSMUST00000212922]

AlphaFold

Q8BI71

Predicted Effect

probably benign
Transcript: ENSMUST00000014981

SMART Domains

Protein: ENSMUSP00000014981
Gene: ENSMUSG00000014837

Domain	Start	End	E-Value	Type
DUF1704	148	457	1.07e-139	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000015003

SMART Domains

Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
E2F_TDP	17	83	3.56e-31	SMART
Pfam:E2F_CC-MB	100	196	2.8e-36	PFAM
low complexity region	201	252	N/A	INTRINSIC
low complexity region	360	372	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000057855
AA Change: T346K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251
AA Change: T346K

Domain	Start	End	E-Value	Type
Pfam:Sec6	189	722	5.4e-116	PFAM
low complexity region	723	739	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171788

SMART Domains

Protein: ENSMUSP00000128530
Gene: ENSMUSG00000014837

Domain	Start	End	E-Value	Type
DUF1704	148	457	1.07e-139	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212138

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212215

Predicted Effect

probably benign
Transcript: ENSMUST00000212219

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212232

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212261

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212288

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212359

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212974

Predicted Effect

probably benign
Transcript: ENSMUST00000212777

Predicted Effect

probably benign
Transcript: ENSMUST00000212922

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212529

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

100% (39/39)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,376,594	H718Y	probably damaging	Het
Abcc8	G	A	7: 46,150,861	T499I	possibly damaging	Het
Azin2	C	A	4: 128,934,466	R316L	probably damaging	Het
Cep85l	C	T	10: 53,278,092	V702I	probably benign	Het
Cfap69	A	T	5: 5,617,220	C442S	probably damaging	Het
Commd3	G	A	2: 18,674,839	G148R	probably benign	Het
Cyfip2	T	C	11: 46,196,308	T1252A	probably benign	Het
Cyp4a30b	A	T	4: 115,456,708	D162V	probably damaging	Het
Gas8	T	C	8: 123,524,157	V123A	probably benign	Het
Gm8890	A	G	5: 11,257,308	Y51C	probably benign	Het
Hmcn2	T	G	2: 31,356,342	D774E	possibly damaging	Het
Itga1	G	T	13: 114,992,501	S540R	probably damaging	Het
Itpr2	T	C	6: 146,329,727	N1145S	probably damaging	Het
Kcnc2	C	T	10: 112,462,067		probably benign	Het
Lrp5	G	A	19: 3,652,296	R174W	probably damaging	Het
Lrrn4	T	G	2: 132,870,326	S526R	probably benign	Het
Map3k6	G	A	4: 133,248,078	R708H	probably damaging	Het
Mefv	T	C	16: 3,715,946	T154A	probably benign	Het
Mkl2	T	A	16: 13,379,850	S66R	probably damaging	Het
Mtif2	G	T	11: 29,536,949	A320S	possibly damaging	Het
Nos2	A	G	11: 78,955,464		probably null	Het
Olfr1006	A	G	2: 85,674,840	S104P	possibly damaging	Het
Olfr725	A	G	14: 50,034,809	L198P	probably damaging	Het
Pip5k1c	T	C	10: 81,310,817	Y44H	probably damaging	Het
Ppp1r13b	T	C	12: 111,831,567	E972G	probably damaging	Het
Prdm12	T	C	2: 31,640,309	S71P	probably damaging	Het
Prkag2	G	T	5: 25,100,288		probably benign	Het
Ptprb	T	C	10: 116,346,820	L1467P	probably damaging	Het
Rnf43	G	A	11: 87,732,163	V697I	probably benign	Het
Rpl7	C	A	1: 16,103,665	A12S	probably benign	Het
Slc25a54	T	G	3: 109,094,256	I120S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,788	H370R	probably damaging	Het
Sv2c	C	T	13: 96,048,525	V215I	probably benign	Het
Synpo2l	T	C	14: 20,662,450	E34G	probably damaging	Het
Tubgcp5	T	A	7: 55,817,392	C703*	probably null	Het
Vmn1r158	T	C	7: 22,790,691	K31R	probably benign	Het
Vmn2r106	C	T	17: 20,268,463	C558Y	probably damaging	Het
Zfp2	A	T	11: 50,900,407	C270S	probably damaging	Het

Other mutations in Exoc3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Exoc3l	APN	8	105290498	missense	probably benign	0.25
IGL01731:Exoc3l	APN	8	105292955	missense	probably benign	0.16
IGL02364:Exoc3l	APN	8	105290577	missense	possibly damaging	0.71
IGL02413:Exoc3l	APN	8	105292438	missense	probably damaging	1.00
IGL02512:Exoc3l	APN	8	105290483	missense	probably damaging	1.00
IGL02810:Exoc3l	APN	8	105295348	missense	probably damaging	1.00
R0045:Exoc3l	UTSW	8	105293685	missense	probably damaging	1.00
R0045:Exoc3l	UTSW	8	105293685	missense	probably damaging	1.00
R0183:Exoc3l	UTSW	8	105295300	missense	probably damaging	1.00
R0302:Exoc3l	UTSW	8	105293543	missense	probably benign	0.01
R1660:Exoc3l	UTSW	8	105293060	critical splice donor site	probably null
R1699:Exoc3l	UTSW	8	105295013	missense	probably benign	0.34
R1826:Exoc3l	UTSW	8	105293618	missense	probably damaging	0.97
R2275:Exoc3l	UTSW	8	105290447	critical splice donor site	probably null
R3928:Exoc3l	UTSW	8	105290917	unclassified	probably benign
R3938:Exoc3l	UTSW	8	105293405	missense	probably damaging	1.00
R4261:Exoc3l	UTSW	8	105290967	missense	probably damaging	0.98
R4273:Exoc3l	UTSW	8	105289961	makesense	probably null
R5518:Exoc3l	UTSW	8	105293163	missense	probably benign	0.27
R6471:Exoc3l	UTSW	8	105290534	missense	probably damaging	1.00
R6631:Exoc3l	UTSW	8	105295361	missense	probably damaging	1.00
R6694:Exoc3l	UTSW	8	105290490	missense	probably benign	0.15
R6843:Exoc3l	UTSW	8	105290097	missense	probably benign	0.00
R7310:Exoc3l	UTSW	8	105293708	missense	probably damaging	1.00
R7387:Exoc3l	UTSW	8	105294973	missense	probably damaging	1.00
R7442:Exoc3l	UTSW	8	105292926	missense	probably damaging	1.00
R7764:Exoc3l	UTSW	8	105290701	missense	possibly damaging	0.62
R7845:Exoc3l	UTSW	8	105290150	missense	probably damaging	1.00
R8748:Exoc3l	UTSW	8	105290145	missense	probably damaging	0.98
R8879:Exoc3l	UTSW	8	105290549	missense
Z1176:Exoc3l	UTSW	8	105290794	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- CTAGTCACCTGAACCTGAGC -3'
(R):5'- AGACTGAGCGCACAATCCTG -3'

Sequencing Primer
(F):5'- TGAACCTGAGCCACAAAGG -3'
(R):5'- ATGTCTTCGGGCGCTACAG -3'

Posted On

2018-06-06