Incidental Mutation 'R6511:Cep85l'
ID519917
Institutional Source Beutler Lab
Gene Symbol Cep85l
Ensembl Gene ENSMUSG00000038594
Gene Namecentrosomal protein 85-like
SynonymsGm9766
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R6511 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location53273443-53379947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53278092 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 702 (V702I)
Ref Sequence ENSEMBL: ENSMUSP00000152032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095691] [ENSMUST00000220376] [ENSMUST00000220443]
Predicted Effect probably benign
Transcript: ENSMUST00000095691
AA Change: V702I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000093356
Gene: ENSMUSG00000038594
AA Change: V702I

DomainStartEndE-ValueType
coiled coil region 442 578 N/A INTRINSIC
coiled coil region 600 645 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219673
Predicted Effect probably benign
Transcript: ENSMUST00000220376
AA Change: V702I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000220443
AA Change: V804I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a breast cancer antigen. Nothing more is known of its function at this time. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Azin2 C A 4: 128,934,466 R316L probably damaging Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Cyp4a30b A T 4: 115,456,708 D162V probably damaging Het
Exoc3l G T 8: 105,293,255 T346K probably benign Het
Gas8 T C 8: 123,524,157 V123A probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Mtif2 G T 11: 29,536,949 A320S possibly damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr1006 A G 2: 85,674,840 S104P possibly damaging Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Pip5k1c T C 10: 81,310,817 Y44H probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Rpl7 C A 1: 16,103,665 A12S probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Sv2c C T 13: 96,048,525 V215I probably benign Het
Synpo2l T C 14: 20,662,450 E34G probably damaging Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp2 A T 11: 50,900,407 C270S probably damaging Het
Other mutations in Cep85l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0103:Cep85l UTSW 10 53278174 missense possibly damaging 0.53
R0103:Cep85l UTSW 10 53278174 missense possibly damaging 0.53
R0559:Cep85l UTSW 10 53348501 missense probably benign 0.00
R0689:Cep85l UTSW 10 53348847 missense probably damaging 1.00
R0750:Cep85l UTSW 10 53281546 missense probably damaging 0.99
R0969:Cep85l UTSW 10 53281496 missense probably benign 0.00
R1375:Cep85l UTSW 10 53349258 missense probably damaging 0.99
R1542:Cep85l UTSW 10 53301584 missense probably damaging 1.00
R1611:Cep85l UTSW 10 53348681 missense probably benign
R1749:Cep85l UTSW 10 53278154 missense probably damaging 1.00
R1826:Cep85l UTSW 10 53348812 missense possibly damaging 0.89
R2007:Cep85l UTSW 10 53278075 utr 3 prime probably benign
R2043:Cep85l UTSW 10 53358128 missense possibly damaging 0.64
R2144:Cep85l UTSW 10 53358126 missense probably benign 0.04
R2186:Cep85l UTSW 10 53348618 missense probably damaging 0.97
R2201:Cep85l UTSW 10 53348731 missense probably benign 0.01
R3767:Cep85l UTSW 10 53291810 missense probably benign 0.09
R5249:Cep85l UTSW 10 53319594 splice site probably null
R5764:Cep85l UTSW 10 53348994 missense probably benign 0.00
R6207:Cep85l UTSW 10 53281555 missense probably benign
R6333:Cep85l UTSW 10 53349101 nonsense probably null
R6422:Cep85l UTSW 10 53291780 missense possibly damaging 0.62
R6645:Cep85l UTSW 10 53301672 missense probably benign 0.26
R6863:Cep85l UTSW 10 53349118 missense probably damaging 1.00
R6904:Cep85l UTSW 10 53349098 missense probably benign 0.00
R7000:Cep85l UTSW 10 53298199 missense probably damaging 1.00
R7015:Cep85l UTSW 10 53349055 missense possibly damaging 0.89
R7256:Cep85l UTSW 10 53296255 missense probably damaging 1.00
R7425:Cep85l UTSW 10 53301570 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGACCTTAGTAACGTGATG -3'
(R):5'- AAGTGTAAGACTTCCTCTCCAC -3'

Sequencing Primer
(F):5'- ACCTTAGTAACGTGATGTGTTTGCC -3'
(R):5'- CACTTTCTTTACACAGCAATGAACTG -3'
Posted On2018-06-06