Incidental Mutation 'R6511:Pip5k1c'
ID 519918
Institutional Source Beutler Lab
Gene Symbol Pip5k1c
Ensembl Gene ENSMUSG00000034902
Gene Name phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
Synonyms PIP5KIgamma
MMRRC Submission 044639-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6511 (G1)
Quality Score 130.008
Status Validated
Chromosome 10
Chromosomal Location 81292963-81319973 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81310817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 44 (Y44H)
Ref Sequence ENSEMBL: ENSMUSP00000125461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000105327] [ENSMUST00000160291] [ENSMUST00000161719] [ENSMUST00000161854] [ENSMUST00000161869] [ENSMUST00000163075]
AlphaFold O70161
Predicted Effect possibly damaging
Transcript: ENSMUST00000045469
AA Change: Y354H

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902
AA Change: Y354H

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105327
AA Change: Y354H

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902
AA Change: Y354H

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159895
Predicted Effect probably benign
Transcript: ENSMUST00000160291
SMART Domains Protein: ENSMUSP00000125645
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161586
SMART Domains Protein: ENSMUSP00000124612
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 54 81 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161719
AA Change: Y44H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125461
Gene: ENSMUSG00000034902
AA Change: Y44H

DomainStartEndE-ValueType
Pfam:PIP5K 1 133 1.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161854
SMART Domains Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161869
SMART Domains Protein: ENSMUSP00000124235
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163075
AA Change: Y354H

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902
AA Change: Y354H

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Meta Mutation Damage Score 0.1746 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mutations in this locus cause variable phenotypes. One allele shows embryonic lethality, abnormal cardiovascular and neuronal development and impaired integrity of the megakaryocyte membrane cytoskeleton. Another allele exhibits neonatal lethality, synaptic transmission and plasticity defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Azin2 C A 4: 128,934,466 R316L probably damaging Het
Cep85l C T 10: 53,278,092 V702I probably benign Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Cyp4a30b A T 4: 115,456,708 D162V probably damaging Het
Exoc3l G T 8: 105,293,255 T346K probably benign Het
Gas8 T C 8: 123,524,157 V123A probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Mtif2 G T 11: 29,536,949 A320S possibly damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr1006 A G 2: 85,674,840 S104P possibly damaging Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Rpl7 C A 1: 16,103,665 A12S probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Sv2c C T 13: 96,048,525 V215I probably benign Het
Synpo2l T C 14: 20,662,450 E34G probably damaging Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp2 A T 11: 50,900,407 C270S probably damaging Het
Other mutations in Pip5k1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pip5k1c APN 10 81305711 missense probably benign 0.45
IGL02274:Pip5k1c APN 10 81306384 missense probably damaging 1.00
IGL02500:Pip5k1c APN 10 81317321 splice site probably null
IGL02565:Pip5k1c APN 10 81317321 splice site probably null
IGL02577:Pip5k1c APN 10 81317321 splice site probably null
IGL02579:Pip5k1c APN 10 81317321 splice site probably null
IGL02581:Pip5k1c APN 10 81317321 splice site probably null
IGL02604:Pip5k1c APN 10 81317321 splice site probably null
IGL02610:Pip5k1c APN 10 81317321 splice site probably null
IGL02613:Pip5k1c APN 10 81317321 splice site probably null
IGL02616:Pip5k1c APN 10 81317321 splice site probably null
IGL02617:Pip5k1c APN 10 81317321 splice site probably null
IGL02639:Pip5k1c APN 10 81317321 splice site probably null
IGL02641:Pip5k1c APN 10 81317321 splice site probably null
IGL02642:Pip5k1c APN 10 81317321 splice site probably null
IGL02724:Pip5k1c APN 10 81313462 missense probably benign 0.01
IGL02751:Pip5k1c APN 10 81317321 splice site probably null
PIT4366001:Pip5k1c UTSW 10 81309008 missense probably damaging 0.98
R0257:Pip5k1c UTSW 10 81315096 missense possibly damaging 0.86
R1643:Pip5k1c UTSW 10 81314994 missense probably damaging 1.00
R1663:Pip5k1c UTSW 10 81312515 missense probably damaging 1.00
R1872:Pip5k1c UTSW 10 81306319 missense probably damaging 0.99
R2293:Pip5k1c UTSW 10 81314084 missense possibly damaging 0.82
R2295:Pip5k1c UTSW 10 81305186 missense probably benign 0.40
R2310:Pip5k1c UTSW 10 81306308 missense probably damaging 0.96
R2406:Pip5k1c UTSW 10 81309024 missense probably damaging 1.00
R4504:Pip5k1c UTSW 10 81315111 missense probably damaging 0.98
R4772:Pip5k1c UTSW 10 81315940 missense probably benign
R5022:Pip5k1c UTSW 10 81310889 splice site probably null
R5023:Pip5k1c UTSW 10 81310889 splice site probably null
R5033:Pip5k1c UTSW 10 81305250 missense probably damaging 0.99
R5057:Pip5k1c UTSW 10 81310889 splice site probably null
R5482:Pip5k1c UTSW 10 81293063 missense probably damaging 0.98
R6305:Pip5k1c UTSW 10 81315934 missense probably benign 0.02
R6544:Pip5k1c UTSW 10 81308996 missense probably damaging 1.00
R7512:Pip5k1c UTSW 10 81315119 critical splice donor site probably null
R7581:Pip5k1c UTSW 10 81308960 missense probably damaging 1.00
R8218:Pip5k1c UTSW 10 81306416 missense probably damaging 1.00
R8686:Pip5k1c UTSW 10 81311993 missense probably damaging 0.99
R8927:Pip5k1c UTSW 10 81293072 missense possibly damaging 0.95
R8928:Pip5k1c UTSW 10 81293072 missense possibly damaging 0.95
R9048:Pip5k1c UTSW 10 81316876 intron probably benign
R9049:Pip5k1c UTSW 10 81316876 intron probably benign
R9100:Pip5k1c UTSW 10 81309222 missense probably benign 0.01
R9443:Pip5k1c UTSW 10 81317350 missense probably damaging 0.99
R9448:Pip5k1c UTSW 10 81305811 missense probably damaging 1.00
R9466:Pip5k1c UTSW 10 81316876 intron probably benign
R9775:Pip5k1c UTSW 10 81312019 missense probably damaging 0.98
R9780:Pip5k1c UTSW 10 81305196 missense probably benign 0.01
Z1177:Pip5k1c UTSW 10 81315032 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GACAACACTTAGACCCCTTTGC -3'
(R):5'- TCACTGCAAAGCCACTGTC -3'

Sequencing Primer
(F):5'- CCTTTGCCAGGGTGCTG -3'
(R):5'- GCTGGCCTAGAACTCATGAGATTC -3'
Posted On 2018-06-06