Incidental Mutation 'R6511:Mtif2'
ID519922
Institutional Source Beutler Lab
Gene Symbol Mtif2
Ensembl Gene ENSMUSG00000020459
Gene Namemitochondrial translational initiation factor 2
Synonyms2310038D14Rik, 2410112O06Rik, IF-2mt
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R6511 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location29526408-29545279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 29536949 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 320 (A320S)
Ref Sequence ENSEMBL: ENSMUSP00000090926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020749] [ENSMUST00000093239] [ENSMUST00000133452] [ENSMUST00000136351] [ENSMUST00000144321]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020749
AA Change: A320S

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020749
Gene: ENSMUSG00000020459
AA Change: A320S

DomainStartEndE-ValueType
Pfam:SRPRB 178 310 2.1e-6 PFAM
Pfam:GTP_EFTU 179 344 8.9e-34 PFAM
Pfam:MMR_HSR1 182 289 6.9e-10 PFAM
coiled coil region 449 484 N/A INTRINSIC
Pfam:IF-2 504 607 6.5e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093239
AA Change: A320S

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090926
Gene: ENSMUSG00000020459
AA Change: A320S

DomainStartEndE-ValueType
Pfam:SRPRB 178 310 2.1e-6 PFAM
Pfam:GTP_EFTU 179 344 8.9e-34 PFAM
Pfam:MMR_HSR1 182 289 6.9e-10 PFAM
coiled coil region 449 484 N/A INTRINSIC
Pfam:IF-2 504 607 6.5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129893
Predicted Effect unknown
Transcript: ENSMUST00000132783
AA Change: A129S
SMART Domains Protein: ENSMUSP00000121327
Gene: ENSMUSG00000020459
AA Change: A129S

DomainStartEndE-ValueType
PDB:3IZY|P 47 247 8e-92 PDB
SCOP:d1g7sa1 163 244 2e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133452
Predicted Effect probably benign
Transcript: ENSMUST00000136351
SMART Domains Protein: ENSMUSP00000122801
Gene: ENSMUSG00000020459

DomainStartEndE-ValueType
SCOP:d1f5na2 157 196 1e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144321
AA Change: A320S

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114299
Gene: ENSMUSG00000020459
AA Change: A320S

DomainStartEndE-ValueType
Pfam:Arf 175 341 1.1e-5 PFAM
Pfam:SRPRB 178 310 1.5e-6 PFAM
Pfam:GTP_EFTU 178 344 3.8e-39 PFAM
Pfam:MMR_HSR1 182 289 1.1e-8 PFAM
Pfam:Miro 182 291 1.2e-9 PFAM
Meta Mutation Damage Score 0.1664 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] During the initiation of protein biosynthesis, initiation factor-2 (IF-2) promotes the binding of the initiator tRNA to the small subunit of the ribosome in a GTP-dependent manner. Prokaryotic IF-2 is a single polypeptide, while eukaryotic cytoplasmic IF-2 (eIF-2) is a trimeric protein. Bovine liver mitochondria contain IF-2(mt), an 85-kD monomeric protein that is equivalent to prokaryotic IF-2. The predicted 727-amino acid human protein contains a 29-amino acid presequence. Human IF-2(mt) shares 32 to 38% amino acid sequence identity with yeast IF-2(mt) and several prokaryotic IF-2s, with the greatest degree of conservation in the G domains of the proteins. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Azin2 C A 4: 128,934,466 R316L probably damaging Het
Cep85l C T 10: 53,278,092 V702I probably benign Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Cyp4a30b A T 4: 115,456,708 D162V probably damaging Het
Exoc3l G T 8: 105,293,255 T346K probably benign Het
Gas8 T C 8: 123,524,157 V123A probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr1006 A G 2: 85,674,840 S104P possibly damaging Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Pip5k1c T C 10: 81,310,817 Y44H probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Rpl7 C A 1: 16,103,665 A12S probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Sv2c C T 13: 96,048,525 V215I probably benign Het
Synpo2l T C 14: 20,662,450 E34G probably damaging Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp2 A T 11: 50,900,407 C270S probably damaging Het
Other mutations in Mtif2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Mtif2 APN 11 29538753 missense probably damaging 1.00
IGL01020:Mtif2 APN 11 29544973 missense possibly damaging 0.61
IGL01323:Mtif2 APN 11 29541447 missense probably damaging 0.98
IGL01360:Mtif2 APN 11 29530110 missense probably benign 0.00
IGL01744:Mtif2 APN 11 29544417 unclassified probably benign
IGL01757:Mtif2 APN 11 29541337 unclassified probably benign
IGL02247:Mtif2 APN 11 29540642 missense possibly damaging 0.65
IGL02642:Mtif2 APN 11 29544395 missense probably benign
IGL03093:Mtif2 APN 11 29530702 splice site probably benign
R0418:Mtif2 UTSW 11 29533401 splice site probably benign
R0554:Mtif2 UTSW 11 29533398 critical splice donor site probably null
R0577:Mtif2 UTSW 11 29540862 critical splice donor site probably null
R1159:Mtif2 UTSW 11 29540729 missense possibly damaging 0.95
R1168:Mtif2 UTSW 11 29536914 missense probably benign 0.11
R1344:Mtif2 UTSW 11 29545002 missense probably benign
R1418:Mtif2 UTSW 11 29545002 missense probably benign
R1482:Mtif2 UTSW 11 29536847 missense probably damaging 1.00
R1657:Mtif2 UTSW 11 29540721 missense probably benign 0.00
R1850:Mtif2 UTSW 11 29540683 missense probably benign 0.03
R3692:Mtif2 UTSW 11 29540718 missense probably benign 0.03
R4471:Mtif2 UTSW 11 29540053 splice site probably benign
R4730:Mtif2 UTSW 11 29540834 missense probably benign 0.00
R5248:Mtif2 UTSW 11 29536889 missense probably damaging 1.00
R5343:Mtif2 UTSW 11 29536964 missense probably damaging 1.00
R5989:Mtif2 UTSW 11 29530098 missense probably damaging 0.96
R7209:Mtif2 UTSW 11 29529996 missense probably benign 0.00
R7318:Mtif2 UTSW 11 29540115 missense probably benign 0.25
X0064:Mtif2 UTSW 11 29538760 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAGATTGGTATTTCTCACAGCG -3'
(R):5'- AGGTGGAACATAGCTTTAATTCCAGC -3'

Sequencing Primer
(F):5'- CTCACAGCGAATGTCTGGAATTG -3'
(R):5'- GAACATAGCTTTAATTCCAGCACTTG -3'
Posted On2018-06-06