Incidental Mutation 'R6511:Cyfip2'
ID519923
Institutional Source Beutler Lab
Gene Symbol Cyfip2
Ensembl Gene ENSMUSG00000020340
Gene Namecytoplasmic FMR1 interacting protein 2
Synonyms1500004I01Rik, Pir121, 6430511D02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6511 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location46193850-46312859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46196308 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1252 (T1252A)
Ref Sequence ENSEMBL: ENSMUSP00000127586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093165] [ENSMUST00000093166] [ENSMUST00000165599]
Predicted Effect probably benign
Transcript: ENSMUST00000093165
AA Change: T1252A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000090853
Gene: ENSMUSG00000020340
AA Change: T1252A

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 303 5.4e-12 PFAM
Pfam:FragX_IP 388 1221 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093166
AA Change: T1252A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000090854
Gene: ENSMUSG00000020340
AA Change: T1252A

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 384 1223 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142017
AA Change: T946A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119801
Gene: ENSMUSG00000020340
AA Change: T946A

DomainStartEndE-ValueType
Pfam:FragX_IP 58 230 4e-66 PFAM
Pfam:FragX_IP 246 916 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165599
AA Change: T1252A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127586
Gene: ENSMUSG00000020340
AA Change: T1252A

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 384 1223 N/A PFAM
Meta Mutation Damage Score 0.1690 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out allele exhibit complete neonatal lethality. Mice homozygous for a dominant spontaneous mutation exhibit impaired behavioral response to cocaine, fewer dendritic spines and reduced miniature excitatory postsynaptic current frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Azin2 C A 4: 128,934,466 R316L probably damaging Het
Cep85l C T 10: 53,278,092 V702I probably benign Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyp4a30b A T 4: 115,456,708 D162V probably damaging Het
Exoc3l G T 8: 105,293,255 T346K probably benign Het
Gas8 T C 8: 123,524,157 V123A probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Mtif2 G T 11: 29,536,949 A320S possibly damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr1006 A G 2: 85,674,840 S104P possibly damaging Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Pip5k1c T C 10: 81,310,817 Y44H probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Rpl7 C A 1: 16,103,665 A12S probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Sv2c C T 13: 96,048,525 V215I probably benign Het
Synpo2l T C 14: 20,662,450 E34G probably damaging Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp2 A T 11: 50,900,407 C270S probably damaging Het
Other mutations in Cyfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Cyfip2 APN 11 46200685 missense possibly damaging 0.74
IGL01352:Cyfip2 APN 11 46265996 missense probably benign 0.01
IGL01685:Cyfip2 APN 11 46207488 splice site probably benign
IGL02367:Cyfip2 APN 11 46276905 nonsense probably null
IGL02390:Cyfip2 APN 11 46221398 missense possibly damaging 0.58
IGL02471:Cyfip2 APN 11 46200803 missense possibly damaging 0.58
IGL02583:Cyfip2 APN 11 46249758 missense possibly damaging 0.56
IGL03199:Cyfip2 APN 11 46276843 missense probably benign 0.07
assunder UTSW 11 46196308 missense probably benign 0.00
fragmentary UTSW 11 46198996 missense probably benign 0.01
IGL02835:Cyfip2 UTSW 11 46249771 missense probably benign 0.00
R0081:Cyfip2 UTSW 11 46253998 nonsense probably null
R0288:Cyfip2 UTSW 11 46253972 missense possibly damaging 0.94
R1830:Cyfip2 UTSW 11 46199019 missense probably damaging 1.00
R1869:Cyfip2 UTSW 11 46224168 missense probably benign 0.40
R1989:Cyfip2 UTSW 11 46253998 nonsense probably null
R2045:Cyfip2 UTSW 11 46249789 missense probably benign 0.00
R2101:Cyfip2 UTSW 11 46242443 missense probably damaging 1.00
R2131:Cyfip2 UTSW 11 46286131 missense possibly damaging 0.78
R2162:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R2299:Cyfip2 UTSW 11 46286131 missense probably benign 0.02
R3831:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3832:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3833:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3881:Cyfip2 UTSW 11 46208335 missense probably damaging 1.00
R4127:Cyfip2 UTSW 11 46270647 missense probably benign 0.00
R4385:Cyfip2 UTSW 11 46242403 missense probably benign 0.05
R4617:Cyfip2 UTSW 11 46254018 missense probably damaging 1.00
R4739:Cyfip2 UTSW 11 46279993 missense probably damaging 0.99
R5232:Cyfip2 UTSW 11 46242378 missense probably damaging 1.00
R5365:Cyfip2 UTSW 11 46247630 missense probably damaging 0.99
R5383:Cyfip2 UTSW 11 46278091 missense possibly damaging 0.83
R5447:Cyfip2 UTSW 11 46291586 missense possibly damaging 0.72
R5450:Cyfip2 UTSW 11 46284252 missense probably benign 0.00
R5796:Cyfip2 UTSW 11 46198996 missense probably benign 0.01
R5820:Cyfip2 UTSW 11 46200704 missense probably damaging 1.00
R5925:Cyfip2 UTSW 11 46207436 missense probably damaging 1.00
R6143:Cyfip2 UTSW 11 46253965 nonsense probably null
R6321:Cyfip2 UTSW 11 46291520 missense probably benign 0.01
R6502:Cyfip2 UTSW 11 46221346 missense probably damaging 1.00
R6521:Cyfip2 UTSW 11 46254588 missense probably damaging 1.00
R6660:Cyfip2 UTSW 11 46249807 missense possibly damaging 0.89
R6836:Cyfip2 UTSW 11 46272640 missense probably benign 0.16
R6866:Cyfip2 UTSW 11 46242459 nonsense probably null
R7062:Cyfip2 UTSW 11 46260832 missense probably damaging 1.00
R7192:Cyfip2 UTSW 11 46254666 missense probably benign 0.21
R7231:Cyfip2 UTSW 11 46224136 missense probably benign
R7258:Cyfip2 UTSW 11 46224177 missense probably benign 0.02
R7365:Cyfip2 UTSW 11 46207440 nonsense probably null
R7441:Cyfip2 UTSW 11 46196427 missense possibly damaging 0.80
R7561:Cyfip2 UTSW 11 46270598 missense probably benign 0.00
R7831:Cyfip2 UTSW 11 46196446 missense probably damaging 1.00
R7871:Cyfip2 UTSW 11 46242350 missense probably damaging 1.00
R8794:Cyfip2 UTSW 11 46253973 missense possibly damaging 0.91
Z1176:Cyfip2 UTSW 11 46222615 missense not run
Z1177:Cyfip2 UTSW 11 46222615 missense not run
Predicted Primers PCR Primer
(F):5'- TATCATGGGAGGAACATGCG -3'
(R):5'- TGTCAGGAATCTGGACTGCAG -3'

Sequencing Primer
(F):5'- CGGGAGCCCAGCCCTTG -3'
(R):5'- AATCTGGACTGCAGCCCCC -3'
Posted On2018-06-06