Incidental Mutation 'R6511:Zfp2'
ID519924
Institutional Source Beutler Lab
Gene Symbol Zfp2
Ensembl Gene ENSMUSG00000049321
Gene Namezinc finger protein 2
SynonymsZfp-2, Fnp-2, 9930007F06Rik, mkr-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6511 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location50898712-50916165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50900407 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 270 (C270S)
Ref Sequence ENSEMBL: ENSMUSP00000112079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109128] [ENSMUST00000109129] [ENSMUST00000116378]
Predicted Effect probably damaging
Transcript: ENSMUST00000109128
AA Change: C270S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104756
Gene: ENSMUSG00000049321
AA Change: C270S

DomainStartEndE-ValueType
ZnF_C2H2 100 122 4.87e-4 SMART
ZnF_C2H2 128 150 1.04e-3 SMART
ZnF_C2H2 156 178 5.59e-4 SMART
ZnF_C2H2 184 206 3.69e-4 SMART
ZnF_C2H2 212 234 9.08e-4 SMART
ZnF_C2H2 240 262 1.04e-3 SMART
ZnF_C2H2 268 290 1.58e-3 SMART
ZnF_C2H2 296 318 2.27e-4 SMART
ZnF_C2H2 324 346 9.08e-4 SMART
ZnF_C2H2 352 374 1.38e-3 SMART
ZnF_C2H2 380 402 2.43e-4 SMART
ZnF_C2H2 408 430 1.95e-3 SMART
ZnF_C2H2 436 458 2.15e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109129
AA Change: C270S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104757
Gene: ENSMUSG00000049321
AA Change: C270S

DomainStartEndE-ValueType
ZnF_C2H2 100 122 4.87e-4 SMART
ZnF_C2H2 128 150 1.04e-3 SMART
ZnF_C2H2 156 178 5.59e-4 SMART
ZnF_C2H2 184 206 3.69e-4 SMART
ZnF_C2H2 212 234 9.08e-4 SMART
ZnF_C2H2 240 262 1.04e-3 SMART
ZnF_C2H2 268 290 1.58e-3 SMART
ZnF_C2H2 296 318 2.27e-4 SMART
ZnF_C2H2 324 346 9.08e-4 SMART
ZnF_C2H2 352 374 1.38e-3 SMART
ZnF_C2H2 380 402 2.43e-4 SMART
ZnF_C2H2 408 430 1.95e-3 SMART
ZnF_C2H2 436 458 2.15e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116378
AA Change: C270S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112079
Gene: ENSMUSG00000049321
AA Change: C270S

DomainStartEndE-ValueType
ZnF_C2H2 100 122 4.87e-4 SMART
ZnF_C2H2 128 150 1.04e-3 SMART
ZnF_C2H2 156 178 5.59e-4 SMART
ZnF_C2H2 184 206 3.69e-4 SMART
ZnF_C2H2 212 234 9.08e-4 SMART
ZnF_C2H2 240 262 1.04e-3 SMART
ZnF_C2H2 268 290 1.58e-3 SMART
ZnF_C2H2 296 318 2.27e-4 SMART
ZnF_C2H2 324 346 9.08e-4 SMART
ZnF_C2H2 352 374 1.38e-3 SMART
ZnF_C2H2 380 402 2.43e-4 SMART
ZnF_C2H2 408 430 1.95e-3 SMART
ZnF_C2H2 436 458 2.15e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150903
Meta Mutation Damage Score 0.8413 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Azin2 C A 4: 128,934,466 R316L probably damaging Het
Cep85l C T 10: 53,278,092 V702I probably benign Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Cyp4a30b A T 4: 115,456,708 D162V probably damaging Het
Exoc3l G T 8: 105,293,255 T346K probably benign Het
Gas8 T C 8: 123,524,157 V123A probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Mtif2 G T 11: 29,536,949 A320S possibly damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr1006 A G 2: 85,674,840 S104P possibly damaging Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Pip5k1c T C 10: 81,310,817 Y44H probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Rpl7 C A 1: 16,103,665 A12S probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Sv2c C T 13: 96,048,525 V215I probably benign Het
Synpo2l T C 14: 20,662,450 E34G probably damaging Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Other mutations in Zfp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Zfp2 APN 11 50901004 missense probably benign 0.00
inanes UTSW 11 50900407 missense probably damaging 1.00
R0689:Zfp2 UTSW 11 50900907 missense probably benign 0.00
R1851:Zfp2 UTSW 11 50901088 missense probably benign 0.06
R1938:Zfp2 UTSW 11 50899982 missense possibly damaging 0.61
R2084:Zfp2 UTSW 11 50900962 missense probably benign
R3859:Zfp2 UTSW 11 50900096 missense possibly damaging 0.93
R4899:Zfp2 UTSW 11 50900014 missense probably damaging 1.00
R5294:Zfp2 UTSW 11 50901241 start gained probably benign
R5511:Zfp2 UTSW 11 50900024 missense probably damaging 0.97
R5583:Zfp2 UTSW 11 50900157 missense possibly damaging 0.83
R6358:Zfp2 UTSW 11 50900601 missense probably damaging 0.99
R7290:Zfp2 UTSW 11 50900743 missense probably damaging 1.00
R7740:Zfp2 UTSW 11 50900778 missense probably damaging 1.00
R8534:Zfp2 UTSW 11 50900800 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGCTTTTCCACACTGATTGCA -3'
(R):5'- GGCAGAGTTCATCCCTGCTT -3'

Sequencing Primer
(F):5'- GCATTCAAAAGGTTTCACTCCGGAG -3'
(R):5'- CCCTACAAATGTCATGAGTGTGG -3'
Posted On2018-06-06