Incidental Mutation 'R6511:Sv2c'
ID519928
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Namesynaptic vesicle glycoprotein 2c
Synonyms4930527L09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_029210; MGI: 1922459

Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6511 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location95954594-96132577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96048525 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 215 (V215I)
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
Predicted Effect probably benign
Transcript: ENSMUST00000161263
AA Change: V215I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: V215I

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182289
AA Change: V215I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: V215I

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Azin2 C A 4: 128,934,466 R316L probably damaging Het
Cep85l C T 10: 53,278,092 V702I probably benign Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Cyp4a30b A T 4: 115,456,708 D162V probably damaging Het
Exoc3l G T 8: 105,293,255 T346K probably benign Het
Gas8 T C 8: 123,524,157 V123A probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Mtif2 G T 11: 29,536,949 A320S possibly damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr1006 A G 2: 85,674,840 S104P possibly damaging Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Pip5k1c T C 10: 81,310,817 Y44H probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Rpl7 C A 1: 16,103,665 A12S probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Synpo2l T C 14: 20,662,450 E34G probably damaging Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp2 A T 11: 50,900,407 C270S probably damaging Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96048429 missense probably damaging 1.00
IGL01313:Sv2c APN 13 96088289 missense probably damaging 1.00
IGL02710:Sv2c APN 13 95989141 missense probably damaging 0.99
IGL02990:Sv2c APN 13 96088378 missense probably damaging 1.00
IGL03145:Sv2c APN 13 95989098 missense probably damaging 1.00
D4043:Sv2c UTSW 13 96088481 missense probably benign 0.27
R0390:Sv2c UTSW 13 96088708 missense probably benign
R0849:Sv2c UTSW 13 95989811 missense probably damaging 1.00
R0907:Sv2c UTSW 13 96088255 missense probably damaging 1.00
R1177:Sv2c UTSW 13 95989763 missense possibly damaging 0.79
R1840:Sv2c UTSW 13 95981844 missense probably benign 0.08
R1865:Sv2c UTSW 13 95976775 missense probably benign 0.29
R1959:Sv2c UTSW 13 95976645 missense probably damaging 1.00
R2440:Sv2c UTSW 13 96048576 missense probably damaging 1.00
R4007:Sv2c UTSW 13 95986833 splice site probably benign
R4197:Sv2c UTSW 13 95978128 missense probably damaging 1.00
R4697:Sv2c UTSW 13 95986018 missense possibly damaging 0.64
R4719:Sv2c UTSW 13 95986811 missense probably benign 0.21
R4822:Sv2c UTSW 13 95985949 missense probably damaging 1.00
R5237:Sv2c UTSW 13 95981883 missense possibly damaging 0.76
R5452:Sv2c UTSW 13 95978083 missense probably damaging 1.00
R5531:Sv2c UTSW 13 95961378 missense probably damaging 0.98
R5756:Sv2c UTSW 13 95985967 missense probably benign
R5982:Sv2c UTSW 13 95976063 nonsense probably null
R6220:Sv2c UTSW 13 95976626 missense probably damaging 1.00
R6520:Sv2c UTSW 13 95986721 missense probably benign
R7001:Sv2c UTSW 13 95981953 missense probably benign 0.11
R7073:Sv2c UTSW 13 96088250 missense probably damaging 1.00
R7116:Sv2c UTSW 13 95976644 missense probably damaging 1.00
R7261:Sv2c UTSW 13 96088301 missense probably damaging 1.00
R7374:Sv2c UTSW 13 95989136 missense probably damaging 1.00
R7423:Sv2c UTSW 13 96048548 missense probably benign 0.03
R7626:Sv2c UTSW 13 95985943 missense probably benign 0.13
R7727:Sv2c UTSW 13 95976695 missense possibly damaging 0.89
R7767:Sv2c UTSW 13 95989715 missense probably damaging 1.00
R7818:Sv2c UTSW 13 95986820 nonsense probably null
R7831:Sv2c UTSW 13 95976692 missense probably damaging 1.00
R7991:Sv2c UTSW 13 96088289 missense probably damaging 1.00
R8137:Sv2c UTSW 13 96088663 missense probably damaging 0.96
R8254:Sv2c UTSW 13 96088565 missense probably damaging 1.00
Z1176:Sv2c UTSW 13 95976097 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCTTAGGCTGACACAGAAATAG -3'
(R):5'- GTTTCCCTGCGTAAAGTGCTG -3'

Sequencing Primer
(F):5'- AGAGTAAAACTGTGTGCAATCAC -3'
(R):5'- CGTAAAGTGCTGGAGTGTTTCC -3'
Posted On2018-06-06