Incidental Mutation 'R6511:Synpo2l'
ID519930
Institutional Source Beutler Lab
Gene Symbol Synpo2l
Ensembl Gene ENSMUSG00000039376
Gene Namesynaptopodin 2-like
Synonyms1110054M18Rik, Chap
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R6511 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20658946-20668354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20662450 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 34 (E34G)
Ref Sequence ENSEMBL: ENSMUSP00000112760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057090] [ENSMUST00000117386] [ENSMUST00000119483]
Predicted Effect probably damaging
Transcript: ENSMUST00000057090
AA Change: E260G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053176
Gene: ENSMUSG00000039376
AA Change: E260G

DomainStartEndE-ValueType
PDZ 15 85 3.52e-10 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 151 162 N/A INTRINSIC
low complexity region 202 230 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 563 580 N/A INTRINSIC
low complexity region 591 604 N/A INTRINSIC
low complexity region 700 726 N/A INTRINSIC
low complexity region 781 797 N/A INTRINSIC
low complexity region 867 880 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117386
AA Change: E263G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112792
Gene: ENSMUSG00000039376
AA Change: E263G

DomainStartEndE-ValueType
PDZ 15 88 1.34e-15 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 154 165 N/A INTRINSIC
low complexity region 205 233 N/A INTRINSIC
low complexity region 246 260 N/A INTRINSIC
low complexity region 432 447 N/A INTRINSIC
low complexity region 503 521 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 566 583 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 703 729 N/A INTRINSIC
low complexity region 784 800 N/A INTRINSIC
low complexity region 870 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119483
AA Change: E34G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112760
Gene: ENSMUSG00000039376
AA Change: E34G

DomainStartEndE-ValueType
low complexity region 203 218 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 365 378 N/A INTRINSIC
low complexity region 474 500 N/A INTRINSIC
low complexity region 555 571 N/A INTRINSIC
low complexity region 641 654 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,376,594 H718Y probably damaging Het
Abcc8 G A 7: 46,150,861 T499I possibly damaging Het
Azin2 C A 4: 128,934,466 R316L probably damaging Het
Cep85l C T 10: 53,278,092 V702I probably benign Het
Cfap69 A T 5: 5,617,220 C442S probably damaging Het
Commd3 G A 2: 18,674,839 G148R probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Cyp4a30b A T 4: 115,456,708 D162V probably damaging Het
Exoc3l G T 8: 105,293,255 T346K probably benign Het
Gas8 T C 8: 123,524,157 V123A probably benign Het
Gm8890 A G 5: 11,257,308 Y51C probably benign Het
Hmcn2 T G 2: 31,356,342 D774E possibly damaging Het
Itga1 G T 13: 114,992,501 S540R probably damaging Het
Itpr2 T C 6: 146,329,727 N1145S probably damaging Het
Kcnc2 C T 10: 112,462,067 probably benign Het
Lrp5 G A 19: 3,652,296 R174W probably damaging Het
Lrrn4 T G 2: 132,870,326 S526R probably benign Het
Map3k6 G A 4: 133,248,078 R708H probably damaging Het
Mefv T C 16: 3,715,946 T154A probably benign Het
Mkl2 T A 16: 13,379,850 S66R probably damaging Het
Mtif2 G T 11: 29,536,949 A320S possibly damaging Het
Nos2 A G 11: 78,955,464 probably null Het
Olfr1006 A G 2: 85,674,840 S104P possibly damaging Het
Olfr725 A G 14: 50,034,809 L198P probably damaging Het
Pip5k1c T C 10: 81,310,817 Y44H probably damaging Het
Ppp1r13b T C 12: 111,831,567 E972G probably damaging Het
Prdm12 T C 2: 31,640,309 S71P probably damaging Het
Prkag2 G T 5: 25,100,288 probably benign Het
Ptprb T C 10: 116,346,820 L1467P probably damaging Het
Rnf43 G A 11: 87,732,163 V697I probably benign Het
Rpl7 C A 1: 16,103,665 A12S probably benign Het
Slc25a54 T G 3: 109,094,256 I120S possibly damaging Het
Slc41a2 T C 10: 83,283,788 H370R probably damaging Het
Sv2c C T 13: 96,048,525 V215I probably benign Het
Tubgcp5 T A 7: 55,817,392 C703* probably null Het
Vmn1r158 T C 7: 22,790,691 K31R probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp2 A T 11: 50,900,407 C270S probably damaging Het
Other mutations in Synpo2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0048:Synpo2l UTSW 14 20666272 unclassified probably benign
R0277:Synpo2l UTSW 14 20661788 missense probably damaging 1.00
R0440:Synpo2l UTSW 14 20661398 missense possibly damaging 0.89
R0540:Synpo2l UTSW 14 20660680 missense probably damaging 1.00
R0607:Synpo2l UTSW 14 20660680 missense probably damaging 1.00
R0712:Synpo2l UTSW 14 20661839 missense probably damaging 1.00
R1175:Synpo2l UTSW 14 20668167 missense possibly damaging 0.93
R1563:Synpo2l UTSW 14 20661278 missense probably damaging 1.00
R1729:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R1730:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R1739:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R2199:Synpo2l UTSW 14 20661919 missense probably benign 0.00
R2213:Synpo2l UTSW 14 20660666 missense probably damaging 1.00
R3085:Synpo2l UTSW 14 20662180 missense probably damaging 1.00
R4787:Synpo2l UTSW 14 20661697 missense possibly damaging 0.49
R5256:Synpo2l UTSW 14 20661014 missense probably benign 0.00
R5454:Synpo2l UTSW 14 20662292 missense probably damaging 0.99
R5455:Synpo2l UTSW 14 20662292 missense probably damaging 0.99
R5765:Synpo2l UTSW 14 20666130 missense possibly damaging 0.95
R5950:Synpo2l UTSW 14 20665935 missense probably benign 0.00
R6376:Synpo2l UTSW 14 20660634 missense probably damaging 1.00
R6438:Synpo2l UTSW 14 20661136 missense probably benign 0.00
R6440:Synpo2l UTSW 14 20668176 missense probably damaging 0.98
R6834:Synpo2l UTSW 14 20660634 missense probably damaging 1.00
R7735:Synpo2l UTSW 14 20661175 missense possibly damaging 0.88
R7968:Synpo2l UTSW 14 20666802 splice site probably null
R8250:Synpo2l UTSW 14 20662276 missense probably benign 0.03
R8282:Synpo2l UTSW 14 20661136 missense probably benign 0.00
R8359:Synpo2l UTSW 14 20666140 missense probably benign
R8771:Synpo2l UTSW 14 20660423 missense probably damaging 0.98
R8853:Synpo2l UTSW 14 20661374 missense probably damaging 1.00
Z1088:Synpo2l UTSW 14 20665967 missense probably damaging 0.99
Z1177:Synpo2l UTSW 14 20660504 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATTAGTAAGGCTGCGGGC -3'
(R):5'- TGGATAAGGCTCATCTCCTGG -3'

Sequencing Primer
(F):5'- TCTGAGAAGGTCTCCTCGTCCAG -3'
(R):5'- CTCATCTCCTGGAAAGTAGGAATGC -3'
Posted On2018-06-06