Mutagenetix > Incidental Mutation

Incidental Mutation 'R6511:Mkl2'

519933

Institutional Source

Beutler Lab

Gene Symbol

Mkl2

Ensembl Gene

ENSMUSG00000009569

Gene Name

MKL/myocardin-like 2

Synonyms

Gt4-1, MRTF-B, Mrtfb

MMRRC Submission

044639-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6511 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13256481-13417529 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 13379850 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 66 (S66R)

Ref Sequence

ENSEMBL: ENSMUSP00000122815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009713] [ENSMUST00000149359]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000009713
AA Change: S77R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000009713
Gene: ENSMUSG00000009569
AA Change: S77R

Domain	Start	End	E-Value	Type
RPEL	51	76	9.67e-5	SMART
RPEL	95	120	2.22e-4	SMART
RPEL	139	164	1.56e-8	SMART
low complexity region	217	230	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	329	352	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
SAP	394	428	1.29e-8	SMART
low complexity region	495	510	N/A	INTRINSIC
coiled coil region	552	601	N/A	INTRINSIC
low complexity region	603	617	N/A	INTRINSIC
low complexity region	699	722	N/A	INTRINSIC
low complexity region	749	775	N/A	INTRINSIC
low complexity region	842	854	N/A	INTRINSIC
low complexity region	1039	1050	N/A	INTRINSIC
low complexity region	1057	1074	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140892

Predicted Effect

probably damaging
Transcript: ENSMUST00000149359
AA Change: S66R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122815
Gene: ENSMUSG00000009569
AA Change: S66R

Domain	Start	End	E-Value	Type
RPEL	40	65	4.51e-5	SMART
RPEL	84	109	2.22e-4	SMART
RPEL	128	153	1.56e-8	SMART
low complexity region	206	219	N/A	INTRINSIC
low complexity region	280	293	N/A	INTRINSIC
low complexity region	318	341	N/A	INTRINSIC
low complexity region	358	370	N/A	INTRINSIC
SAP	383	417	1.29e-8	SMART
low complexity region	484	499	N/A	INTRINSIC
coiled coil region	541	590	N/A	INTRINSIC
low complexity region	592	606	N/A	INTRINSIC
low complexity region	688	711	N/A	INTRINSIC
low complexity region	738	764	N/A	INTRINSIC
low complexity region	831	843	N/A	INTRINSIC
low complexity region	1028	1039	N/A	INTRINSIC
low complexity region	1046	1063	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210378

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

100% (39/39)

MGI Phenotype

PHENOTYPE: Mice homozygous for knock-out alleles exhibit prenatal lethality with widespread hemorrhaging, cardiovascular defects, and craniofacial anomalies. Mice homozygous for a gene trap allele exhibit fetal lethality due to cardiac outflow tractdefects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,376,594	H718Y	probably damaging	Het
Abcc8	G	A	7: 46,150,861	T499I	possibly damaging	Het
Azin2	C	A	4: 128,934,466	R316L	probably damaging	Het
Cep85l	C	T	10: 53,278,092	V702I	probably benign	Het
Cfap69	A	T	5: 5,617,220	C442S	probably damaging	Het
Commd3	G	A	2: 18,674,839	G148R	probably benign	Het
Cyfip2	T	C	11: 46,196,308	T1252A	probably benign	Het
Cyp4a30b	A	T	4: 115,456,708	D162V	probably damaging	Het
Exoc3l	G	T	8: 105,293,255	T346K	probably benign	Het
Gas8	T	C	8: 123,524,157	V123A	probably benign	Het
Gm8890	A	G	5: 11,257,308	Y51C	probably benign	Het
Hmcn2	T	G	2: 31,356,342	D774E	possibly damaging	Het
Itga1	G	T	13: 114,992,501	S540R	probably damaging	Het
Itpr2	T	C	6: 146,329,727	N1145S	probably damaging	Het
Kcnc2	C	T	10: 112,462,067		probably benign	Het
Lrp5	G	A	19: 3,652,296	R174W	probably damaging	Het
Lrrn4	T	G	2: 132,870,326	S526R	probably benign	Het
Map3k6	G	A	4: 133,248,078	R708H	probably damaging	Het
Mefv	T	C	16: 3,715,946	T154A	probably benign	Het
Mtif2	G	T	11: 29,536,949	A320S	possibly damaging	Het
Nos2	A	G	11: 78,955,464		probably null	Het
Olfr1006	A	G	2: 85,674,840	S104P	possibly damaging	Het
Olfr725	A	G	14: 50,034,809	L198P	probably damaging	Het
Pip5k1c	T	C	10: 81,310,817	Y44H	probably damaging	Het
Ppp1r13b	T	C	12: 111,831,567	E972G	probably damaging	Het
Prdm12	T	C	2: 31,640,309	S71P	probably damaging	Het
Prkag2	G	T	5: 25,100,288		probably benign	Het
Ptprb	T	C	10: 116,346,820	L1467P	probably damaging	Het
Rnf43	G	A	11: 87,732,163	V697I	probably benign	Het
Rpl7	C	A	1: 16,103,665	A12S	probably benign	Het
Slc25a54	T	G	3: 109,094,256	I120S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,788	H370R	probably damaging	Het
Sv2c	C	T	13: 96,048,525	V215I	probably benign	Het
Synpo2l	T	C	14: 20,662,450	E34G	probably damaging	Het
Tubgcp5	T	A	7: 55,817,392	C703*	probably null	Het
Vmn1r158	T	C	7: 22,790,691	K31R	probably benign	Het
Vmn2r106	C	T	17: 20,268,463	C558Y	probably damaging	Het
Zfp2	A	T	11: 50,900,407	C270S	probably damaging	Het

Other mutations in Mkl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Mkl2	APN	16	13403222	missense	probably benign	0.28
IGL00546:Mkl2	APN	16	13403225	missense	possibly damaging	0.71
IGL01325:Mkl2	APN	16	13401224	missense	probably damaging	1.00
IGL02125:Mkl2	APN	16	13400183	splice site	probably null
IGL02803:Mkl2	APN	16	13403156	missense	possibly damaging	0.94
IGL03143:Mkl2	APN	16	13400812	missense	possibly damaging	0.46
IGL03180:Mkl2	APN	16	13398332	missense	probably damaging	1.00
R0281:Mkl2	UTSW	16	13412163	missense	probably damaging	0.99
R0505:Mkl2	UTSW	16	13412526	missense	possibly damaging	0.80
R0540:Mkl2	UTSW	16	13381601	missense	probably damaging	1.00
R0607:Mkl2	UTSW	16	13381601	missense	probably damaging	1.00
R1073:Mkl2	UTSW	16	13412318	missense	possibly damaging	0.89
R1423:Mkl2	UTSW	16	13412241	missense	possibly damaging	0.96
R1432:Mkl2	UTSW	16	13401002	missense	probably benign	0.01
R1459:Mkl2	UTSW	16	13401569	missense	possibly damaging	0.93
R1693:Mkl2	UTSW	16	13398470	missense	possibly damaging	0.67
R1693:Mkl2	UTSW	16	13398471	missense	probably damaging	0.99
R2006:Mkl2	UTSW	16	13381576	nonsense	probably null
R2076:Mkl2	UTSW	16	13401382	missense	probably benign	0.01
R2125:Mkl2	UTSW	16	13400804	missense	possibly damaging	0.94
R2145:Mkl2	UTSW	16	13412586	missense	probably damaging	0.98
R3722:Mkl2	UTSW	16	13385693	missense	probably damaging	1.00
R3883:Mkl2	UTSW	16	13401458	missense	probably damaging	0.99
R4088:Mkl2	UTSW	16	13384200	missense	probably damaging	0.98
R4204:Mkl2	UTSW	16	13403255	missense	possibly damaging	0.88
R4301:Mkl2	UTSW	16	13398305	missense	probably damaging	1.00
R4622:Mkl2	UTSW	16	13332706	missense	probably damaging	1.00
R4633:Mkl2	UTSW	16	13379873	missense	possibly damaging	0.95
R4765:Mkl2	UTSW	16	13412594	missense	probably damaging	1.00
R5201:Mkl2	UTSW	16	13401592	missense	probably benign	0.00
R5403:Mkl2	UTSW	16	13401013	missense	probably damaging	0.97
R5725:Mkl2	UTSW	16	13384310	nonsense	probably null
R7207:Mkl2	UTSW	16	13326436	missense	probably benign
R7269:Mkl2	UTSW	16	13401034	missense	possibly damaging	0.48
R7311:Mkl2	UTSW	16	13405854	nonsense	probably null
R7460:Mkl2	UTSW	16	13400976	missense	probably benign	0.00
R8480:Mkl2	UTSW	16	13384192	critical splice acceptor site	probably null
R9032:Mkl2	UTSW	16	13412228	missense	probably damaging	1.00
R9085:Mkl2	UTSW	16	13412228	missense	probably damaging	1.00
R9098:Mkl2	UTSW	16	13403189	missense	probably benign
R9229:Mkl2	UTSW	16	13412321	missense	possibly damaging	0.89
R9298:Mkl2	UTSW	16	13384218	missense	probably benign	0.10
R9310:Mkl2	UTSW	16	13401090	missense	probably benign
R9343:Mkl2	UTSW	16	13400927	missense	probably benign	0.00
R9436:Mkl2	UTSW	16	13405287	nonsense	probably null
Z1177:Mkl2	UTSW	16	13385606	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCAAAGAATGTAAGTTCAGTTGGG -3'
(R):5'- ACTGAACTGTCACACACTTTCTG -3'

Sequencing Primer
(F):5'- GGGTAATGTTGAAGAGTCCAAATTTG -3'
(R):5'- ACTGTCACACACTTTCTGAAAATCTC -3'

Posted On

2018-06-06