Incidental Mutation 'R6512:Tbk1'
ID519956
Institutional Source Beutler Lab
Gene Symbol Tbk1
Ensembl Gene ENSMUSG00000020115
Gene NameTANK-binding kinase 1
Synonyms1200008B05Rik
MMRRC Submission
Accession Numbers

MGI: 1929658

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6512 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location121546455-121586787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121578621 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 63 (N63Y)
Ref Sequence ENSEMBL: ENSMUSP00000020316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020316] [ENSMUST00000219400] [ENSMUST00000219493]
PDB Structure
Crystal structure of mouse TBK1 bound to BX795 [X-RAY DIFFRACTION]
Crystal structure of mouse TBK1 bound to SU6668 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000020316
AA Change: N63Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020316
Gene: ENSMUSG00000020115
AA Change: N63Y

DomainStartEndE-ValueType
Pfam:Pkinase 9 300 2.6e-46 PFAM
Pfam:Pkinase_Tyr 10 250 1.5e-27 PFAM
low complexity region 355 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219400
AA Change: N63Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219493
AA Change: N11Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.1837 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality. Mice homozygous for a different knock-out allele exhibit increased prenatal lethality, increased infiltration of mononuclear and/or granulomatous cells in multiple organs and tissues at 3 months of age, and increased lethality in response to LPS. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(5) Gene trapped(18)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,036,863 S211P possibly damaging Het
Abcb11 T C 2: 69,282,652 T674A probably benign Het
Acad11 G T 9: 104,095,559 E484* probably null Het
Ankhd1 A T 18: 36,591,456 D389V probably damaging Het
Asic4 T A 1: 75,473,043 L439* probably null Het
Atp13a2 A G 4: 141,003,218 T808A probably damaging Het
Capn13 C A 17: 73,382,990 V9L probably benign Het
Chst11 A G 10: 83,191,468 Y243C probably damaging Het
Ctdp1 A T 18: 80,451,263 W308R probably damaging Het
Dnttip2 A G 3: 122,275,523 E129G possibly damaging Het
Dock5 A G 14: 67,824,648 S424P possibly damaging Het
Ebf1 C T 11: 44,992,341 H469Y probably damaging Het
Efhc1 A T 1: 20,960,349 N169Y probably damaging Het
Elmo1 T C 13: 20,373,161 L424P probably damaging Het
Ighv1-59 A G 12: 115,335,383 V16A probably damaging Het
Kcnc1 T G 7: 46,427,397 C208G probably damaging Het
Kif13b A T 14: 64,744,874 probably null Het
Lilra6 T A 7: 3,914,388 N203Y probably benign Het
Mkl1 T C 15: 81,013,716 T787A probably benign Het
Myh8 A T 11: 67,289,662 K575* probably null Het
Nedd1 C T 10: 92,691,875 A486T probably benign Het
Olfr170 A T 16: 19,606,359 L103H probably damaging Het
Phrf1 T C 7: 141,260,396 I1168T possibly damaging Het
Pla2g12a T A 3: 129,888,957 H59Q probably benign Het
Ralbp1 A G 17: 65,861,275 V345A probably damaging Het
Ryr3 C T 2: 112,867,378 V894M possibly damaging Het
Sec24b T A 3: 130,041,297 Y84F probably damaging Het
Slc22a26 T C 19: 7,802,500 probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spats1 C T 17: 45,452,673 probably null Het
Tbl1xr1 C T 3: 22,140,534 probably benign Het
Top2b T A 14: 16,409,854 D840E possibly damaging Het
Trpc3 T A 3: 36,662,758 Y377F possibly damaging Het
Uba6 C T 5: 86,124,403 R778K probably benign Het
Vmn2r101 A T 17: 19,588,884 I92F probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r70 G T 7: 85,566,097 F76L probably benign Het
Vwa3b A G 1: 37,063,642 probably benign Het
Zfp407 T A 18: 84,560,349 T880S probably damaging Het
Zfp64 C A 2: 168,894,077 G560V probably benign Het
Other mutations in Tbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Tbk1 APN 10 121552250 missense probably benign 0.00
IGL01021:Tbk1 APN 10 121551272 missense probably benign 0.07
IGL01371:Tbk1 APN 10 121559871 missense probably benign 0.09
IGL01383:Tbk1 APN 10 121576279 missense probably damaging 1.00
IGL01583:Tbk1 APN 10 121557229 missense probably benign
IGL01734:Tbk1 APN 10 121571983 nonsense probably null
IGL02068:Tbk1 APN 10 121570789 missense probably damaging 1.00
IGL02676:Tbk1 APN 10 121568080 missense possibly damaging 0.82
IGL02737:Tbk1 APN 10 121559862 missense probably null 0.96
IGL03334:Tbk1 APN 10 121584199 missense possibly damaging 0.79
Pathfinder UTSW 10 121552501 missense probably damaging 0.98
pioneer UTSW 10 121578690 missense probably damaging 1.00
trailblazer UTSW 10 121570685 missense probably damaging 1.00
BB006:Tbk1 UTSW 10 121557233 missense probably benign 0.00
BB016:Tbk1 UTSW 10 121557233 missense probably benign 0.00
R0030:Tbk1 UTSW 10 121561624 missense probably benign 0.09
R0386:Tbk1 UTSW 10 121584254 missense probably damaging 0.96
R1396:Tbk1 UTSW 10 121571916 missense probably damaging 1.00
R1430:Tbk1 UTSW 10 121559934 missense probably benign
R1522:Tbk1 UTSW 10 121551318 missense probably benign 0.06
R1542:Tbk1 UTSW 10 121559935 missense probably benign
R1717:Tbk1 UTSW 10 121561645 missense probably benign 0.10
R1860:Tbk1 UTSW 10 121547171 missense probably benign 0.01
R2188:Tbk1 UTSW 10 121563931 nonsense probably null
R2519:Tbk1 UTSW 10 121557259 missense probably benign 0.03
R4627:Tbk1 UTSW 10 121568080 missense possibly damaging 0.82
R4945:Tbk1 UTSW 10 121551269 missense probably damaging 0.98
R5061:Tbk1 UTSW 10 121576336 missense possibly damaging 0.62
R5256:Tbk1 UTSW 10 121570685 missense probably damaging 1.00
R5310:Tbk1 UTSW 10 121556051 missense probably benign 0.00
R6187:Tbk1 UTSW 10 121584243 missense probably benign 0.02
R6425:Tbk1 UTSW 10 121563962 missense probably benign 0.00
R6897:Tbk1 UTSW 10 121559877 missense probably benign 0.00
R7268:Tbk1 UTSW 10 121552499 missense probably benign 0.03
R7609:Tbk1 UTSW 10 121552501 missense probably damaging 0.98
R7860:Tbk1 UTSW 10 121552246 missense possibly damaging 0.55
R7929:Tbk1 UTSW 10 121557233 missense probably benign 0.00
R8378:Tbk1 UTSW 10 121578692 missense probably damaging 0.96
X0022:Tbk1 UTSW 10 121560293 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGCATTAGAGAAGTGCTGTGGATAC -3'
(R):5'- TGAGTGCTGAGAGGGTACAC -3'

Sequencing Primer
(F):5'- GGATACAACACTAGGTTACAAGAGCC -3'
(R):5'- TGTGAGCTGAGAGGGTACACTC -3'
Posted On2018-06-06