Incidental Mutation 'R6512:Top2b'
ID 519961
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Name topoisomerase (DNA) II beta
Synonyms Top-2, D230016L12Rik
MMRRC Submission 045017-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.929) question?
Stock # R6512 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 6038976-6104585 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 16409854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 840 (D840E)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
AlphaFold Q64511
Predicted Effect possibly damaging
Transcript: ENSMUST00000017629
AA Change: D840E

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: D840E

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159302
SMART Domains Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 1 177 4.06e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160501
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,347,672 (GRCm39) S211P possibly damaging Het
Abcb11 T C 2: 69,112,996 (GRCm39) T674A probably benign Het
Acad11 G T 9: 103,972,758 (GRCm39) E484* probably null Het
Ankhd1 A T 18: 36,724,509 (GRCm39) D389V probably damaging Het
Asic4 T A 1: 75,449,687 (GRCm39) L439* probably null Het
Atp13a2 A G 4: 140,730,529 (GRCm39) T808A probably damaging Het
Capn13 C A 17: 73,689,985 (GRCm39) V9L probably benign Het
Chst11 A G 10: 83,027,302 (GRCm39) Y243C probably damaging Het
Ctdp1 A T 18: 80,494,478 (GRCm39) W308R probably damaging Het
Dnttip2 A G 3: 122,069,172 (GRCm39) E129G possibly damaging Het
Dock5 A G 14: 68,062,097 (GRCm39) S424P possibly damaging Het
Ebf1 C T 11: 44,883,168 (GRCm39) H469Y probably damaging Het
Efhc1 A T 1: 21,030,573 (GRCm39) N169Y probably damaging Het
Elmo1 T C 13: 20,557,331 (GRCm39) L424P probably damaging Het
Ighv1-59 A G 12: 115,299,003 (GRCm39) V16A probably damaging Het
Kcnc1 T G 7: 46,076,821 (GRCm39) C208G probably damaging Het
Kif13b A T 14: 64,982,323 (GRCm39) probably null Het
Lilra6 T A 7: 3,917,387 (GRCm39) N203Y probably benign Het
Mrtfa T C 15: 80,897,917 (GRCm39) T787A probably benign Het
Myh8 A T 11: 67,180,488 (GRCm39) K575* probably null Het
Nedd1 C T 10: 92,527,737 (GRCm39) A486T probably benign Het
Or2aj5 A T 16: 19,425,109 (GRCm39) L103H probably damaging Het
Phrf1 T C 7: 140,840,309 (GRCm39) I1168T possibly damaging Het
Pla2g12a T A 3: 129,682,606 (GRCm39) H59Q probably benign Het
Ralbp1 A G 17: 66,168,270 (GRCm39) V345A probably damaging Het
Ryr3 C T 2: 112,697,723 (GRCm39) V894M possibly damaging Het
Sec24b T A 3: 129,834,946 (GRCm39) Y84F probably damaging Het
Slc22a26 T C 19: 7,779,865 (GRCm39) probably benign Het
Smc1b C T 15: 84,976,232 (GRCm39) R825Q probably benign Het
Spats1 C T 17: 45,763,599 (GRCm39) probably null Het
Tbk1 T A 10: 121,414,526 (GRCm39) N63Y probably damaging Het
Tbl1xr1 C T 3: 22,194,698 (GRCm39) probably benign Het
Trpc3 T A 3: 36,716,907 (GRCm39) Y377F possibly damaging Het
Uba6 C T 5: 86,272,262 (GRCm39) R778K probably benign Het
Vmn2r101 A T 17: 19,809,146 (GRCm39) I92F probably damaging Het
Vmn2r106 C T 17: 20,488,725 (GRCm39) C558Y probably damaging Het
Vmn2r70 G T 7: 85,215,305 (GRCm39) F76L probably benign Het
Vwa3b A G 1: 37,102,723 (GRCm39) probably benign Het
Zfp407 T A 18: 84,578,474 (GRCm39) T880S probably damaging Het
Zfp64 C A 2: 168,735,997 (GRCm39) G560V probably benign Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16,422,692 (GRCm38) missense probably benign 0.00
IGL00730:Top2b APN 14 16,389,831 (GRCm38) missense probably damaging 1.00
IGL00917:Top2b APN 14 16,407,354 (GRCm38) missense probably benign 0.05
IGL01959:Top2b APN 14 16,422,695 (GRCm38) missense probably benign 0.19
IGL02019:Top2b APN 14 16,409,965 (GRCm38) missense probably benign 0.44
IGL02119:Top2b APN 14 16,406,733 (GRCm38) missense probably damaging 1.00
IGL02136:Top2b APN 14 16,407,103 (GRCm38) unclassified probably benign
IGL02148:Top2b APN 14 16,400,488 (GRCm38) missense probably damaging 1.00
IGL02496:Top2b APN 14 16,387,335 (GRCm38) missense probably benign
IGL02503:Top2b APN 14 16,407,163 (GRCm38) missense possibly damaging 0.92
IGL02672:Top2b APN 14 16,409,166 (GRCm38) unclassified probably benign
IGL02721:Top2b APN 14 16,409,236 (GRCm38) missense probably damaging 1.00
IGL02886:Top2b APN 14 16,365,688 (GRCm38) missense possibly damaging 0.73
IGL03252:Top2b APN 14 16,393,163 (GRCm38) missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16,423,780 (GRCm38) critical splice donor site probably null
R0092:Top2b UTSW 14 16,409,263 (GRCm38) missense probably damaging 1.00
R0201:Top2b UTSW 14 16,383,174 (GRCm38) missense probably damaging 1.00
R0390:Top2b UTSW 14 16,418,442 (GRCm38) missense probably benign 0.00
R0394:Top2b UTSW 14 16,413,556 (GRCm38) splice site probably null
R1159:Top2b UTSW 14 16,430,329 (GRCm38) missense possibly damaging 0.81
R1424:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R1519:Top2b UTSW 14 16,408,953 (GRCm38) splice site probably null
R1561:Top2b UTSW 14 16,398,993 (GRCm38) missense possibly damaging 0.80
R1713:Top2b UTSW 14 16,409,823 (GRCm38) missense probably benign 0.05
R1987:Top2b UTSW 14 16,398,916 (GRCm38) missense probably damaging 0.99
R2219:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2287:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2422:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2679:Top2b UTSW 14 16,413,947 (GRCm38) missense probably damaging 1.00
R3687:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3707:Top2b UTSW 14 16,388,447 (GRCm38) missense probably damaging 1.00
R3810:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3812:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3815:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3816:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3818:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4023:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4025:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4026:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4133:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4157:Top2b UTSW 14 16,384,491 (GRCm38) missense probably benign 0.42
R4179:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4180:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4300:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4376:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4377:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4492:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4549:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4550:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4581:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4582:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4628:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4630:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4667:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4668:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4669:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4698:Top2b UTSW 14 16,387,331 (GRCm38) nonsense probably null
R4769:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R4809:Top2b UTSW 14 16,383,125 (GRCm38) missense probably benign 0.06
R4899:Top2b UTSW 14 16,387,313 (GRCm38) missense probably damaging 1.00
R5035:Top2b UTSW 14 16,409,966 (GRCm38) missense probably benign 0.01
R5621:Top2b UTSW 14 16,387,280 (GRCm38) missense probably damaging 1.00
R5631:Top2b UTSW 14 16,409,882 (GRCm38) missense probably damaging 1.00
R5685:Top2b UTSW 14 16,413,666 (GRCm38) missense probably damaging 1.00
R5732:Top2b UTSW 14 16,400,106 (GRCm38) missense possibly damaging 0.92
R5939:Top2b UTSW 14 16,422,786 (GRCm38) missense probably damaging 0.96
R6007:Top2b UTSW 14 16,423,779 (GRCm38) critical splice donor site probably null
R6087:Top2b UTSW 14 16,409,864 (GRCm38) missense probably benign 0.14
R6144:Top2b UTSW 14 16,423,740 (GRCm38) missense possibly damaging 0.48
R6196:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6218:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6229:Top2b UTSW 14 16,409,838 (GRCm38) missense probably damaging 1.00
R6249:Top2b UTSW 14 16,399,006 (GRCm38) missense probably damaging 1.00
R6337:Top2b UTSW 14 16,399,026 (GRCm38) missense possibly damaging 0.77
R6353:Top2b UTSW 14 16,416,671 (GRCm38) missense probably damaging 1.00
R6573:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R6614:Top2b UTSW 14 16,407,142 (GRCm38) nonsense probably null
R6844:Top2b UTSW 14 16,429,383 (GRCm38) missense possibly damaging 0.94
R6848:Top2b UTSW 14 16,409,958 (GRCm38) missense possibly damaging 0.89
R6871:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6895:Top2b UTSW 14 16,413,604 (GRCm38) missense probably benign 0.06
R7162:Top2b UTSW 14 16,416,653 (GRCm38) missense probably benign 0.00
R7247:Top2b UTSW 14 16,416,962 (GRCm38) missense probably benign 0.08
R7250:Top2b UTSW 14 16,420,411 (GRCm38) missense probably benign
R7359:Top2b UTSW 14 16,407,376 (GRCm38) missense probably null 1.00
R7365:Top2b UTSW 14 16,416,649 (GRCm38) missense probably benign 0.04
R7493:Top2b UTSW 14 16,416,605 (GRCm38) missense probably benign 0.00
R7528:Top2b UTSW 14 16,395,427 (GRCm38) nonsense probably null
R7562:Top2b UTSW 14 16,412,946 (GRCm38) missense probably benign 0.04
R7594:Top2b UTSW 14 16,428,587 (GRCm38) missense probably benign
R7670:Top2b UTSW 14 16,416,620 (GRCm38) missense possibly damaging 0.61
R7894:Top2b UTSW 14 16,413,081 (GRCm38) missense possibly damaging 0.68
R8031:Top2b UTSW 14 16,412,986 (GRCm38) missense probably damaging 0.98
R8150:Top2b UTSW 14 16,393,291 (GRCm38) missense probably damaging 0.99
R8214:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R8299:Top2b UTSW 14 16,386,123 (GRCm38) missense possibly damaging 0.68
R8977:Top2b UTSW 14 16,393,239 (GRCm38) missense probably benign 0.36
R9562:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9565:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9798:Top2b UTSW 14 16,389,845 (GRCm38) missense probably damaging 1.00
X0028:Top2b UTSW 14 16,384,499 (GRCm38) nonsense probably null
Z1176:Top2b UTSW 14 16,395,434 (GRCm38) missense probably damaging 1.00
Z1177:Top2b UTSW 14 16,416,953 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCTTGGGAGAAATATGCC -3'
(R):5'- CGGAGATTTTAAACCCTGATAAGGTAC -3'

Sequencing Primer
(F):5'- CTTGGGAGAAATATGCCTTTTGTAC -3'
(R):5'- TAAAAACTTACCATGGGATGAGGATC -3'
Posted On 2018-06-06