Incidental Mutation 'R6512:Dock5'
ID519963
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Namededicator of cytokinesis 5
Synonymslr2, 1110060D06Rik, rlc
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R6512 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location67752135-67933442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67824648 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 424 (S424P)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039135
AA Change: S424P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: S424P

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224823
Meta Mutation Damage Score 0.0951 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,036,863 S211P possibly damaging Het
Abcb11 T C 2: 69,282,652 T674A probably benign Het
Acad11 G T 9: 104,095,559 E484* probably null Het
Ankhd1 A T 18: 36,591,456 D389V probably damaging Het
Asic4 T A 1: 75,473,043 L439* probably null Het
Atp13a2 A G 4: 141,003,218 T808A probably damaging Het
Capn13 C A 17: 73,382,990 V9L probably benign Het
Chst11 A G 10: 83,191,468 Y243C probably damaging Het
Ctdp1 A T 18: 80,451,263 W308R probably damaging Het
Dnttip2 A G 3: 122,275,523 E129G possibly damaging Het
Ebf1 C T 11: 44,992,341 H469Y probably damaging Het
Efhc1 A T 1: 20,960,349 N169Y probably damaging Het
Elmo1 T C 13: 20,373,161 L424P probably damaging Het
Ighv1-59 A G 12: 115,335,383 V16A probably damaging Het
Kcnc1 T G 7: 46,427,397 C208G probably damaging Het
Kif13b A T 14: 64,744,874 probably null Het
Lilra6 T A 7: 3,914,388 N203Y probably benign Het
Mkl1 T C 15: 81,013,716 T787A probably benign Het
Myh8 A T 11: 67,289,662 K575* probably null Het
Nedd1 C T 10: 92,691,875 A486T probably benign Het
Olfr170 A T 16: 19,606,359 L103H probably damaging Het
Phrf1 T C 7: 141,260,396 I1168T possibly damaging Het
Pla2g12a T A 3: 129,888,957 H59Q probably benign Het
Ralbp1 A G 17: 65,861,275 V345A probably damaging Het
Ryr3 C T 2: 112,867,378 V894M possibly damaging Het
Sec24b T A 3: 130,041,297 Y84F probably damaging Het
Slc22a26 T C 19: 7,802,500 probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spats1 C T 17: 45,452,673 probably null Het
Tbk1 T A 10: 121,578,621 N63Y probably damaging Het
Tbl1xr1 C T 3: 22,140,534 probably benign Het
Top2b T A 14: 16,409,854 D840E possibly damaging Het
Trpc3 T A 3: 36,662,758 Y377F possibly damaging Het
Uba6 C T 5: 86,124,403 R778K probably benign Het
Vmn2r101 A T 17: 19,588,884 I92F probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r70 G T 7: 85,566,097 F76L probably benign Het
Vwa3b A G 1: 37,063,642 probably benign Het
Zfp407 T A 18: 84,560,349 T880S probably damaging Het
Zfp64 C A 2: 168,894,077 G560V probably benign Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCCACTAACCCTAAATGATGTC -3'
(R):5'- AACGATGTTACCCAGGGAGG -3'

Sequencing Primer
(F):5'- AGAGACTCATATTGCCTCAACTGTC -3'
(R):5'- CGATGTTACCCAGGGAGGATTAC -3'
Posted On2018-06-06