Incidental Mutation 'R6512:1700122O11Rik'
ID519970
Institutional Source Beutler Lab
Gene Symbol 1700122O11Rik
Ensembl Gene ENSMUSG00000094928
Gene NameRIKEN cDNA 1700122O11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6512 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location48036745-48038293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48036863 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 211 (S211P)
Ref Sequence ENSEMBL: ENSMUSP00000137519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178823]
Predicted Effect possibly damaging
Transcript: ENSMUST00000178823
AA Change: S211P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137519
Gene: ENSMUSG00000094928
AA Change: S211P

DomainStartEndE-ValueType
coiled coil region 42 73 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,282,652 T674A probably benign Het
Acad11 G T 9: 104,095,559 E484* probably null Het
Ankhd1 A T 18: 36,591,456 D389V probably damaging Het
Asic4 T A 1: 75,473,043 L439* probably null Het
Atp13a2 A G 4: 141,003,218 T808A probably damaging Het
Capn13 C A 17: 73,382,990 V9L probably benign Het
Chst11 A G 10: 83,191,468 Y243C probably damaging Het
Ctdp1 A T 18: 80,451,263 W308R probably damaging Het
Dnttip2 A G 3: 122,275,523 E129G possibly damaging Het
Dock5 A G 14: 67,824,648 S424P possibly damaging Het
Ebf1 C T 11: 44,992,341 H469Y probably damaging Het
Efhc1 A T 1: 20,960,349 N169Y probably damaging Het
Elmo1 T C 13: 20,373,161 L424P probably damaging Het
Ighv1-59 A G 12: 115,335,383 V16A probably damaging Het
Kcnc1 T G 7: 46,427,397 C208G probably damaging Het
Kif13b A T 14: 64,744,874 probably null Het
Lilra6 T A 7: 3,914,388 N203Y probably benign Het
Mkl1 T C 15: 81,013,716 T787A probably benign Het
Myh8 A T 11: 67,289,662 K575* probably null Het
Nedd1 C T 10: 92,691,875 A486T probably benign Het
Olfr170 A T 16: 19,606,359 L103H probably damaging Het
Phrf1 T C 7: 141,260,396 I1168T possibly damaging Het
Pla2g12a T A 3: 129,888,957 H59Q probably benign Het
Ralbp1 A G 17: 65,861,275 V345A probably damaging Het
Ryr3 C T 2: 112,867,378 V894M possibly damaging Het
Sec24b T A 3: 130,041,297 Y84F probably damaging Het
Slc22a26 T C 19: 7,802,500 probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spats1 C T 17: 45,452,673 probably null Het
Tbk1 T A 10: 121,578,621 N63Y probably damaging Het
Tbl1xr1 C T 3: 22,140,534 probably benign Het
Top2b T A 14: 16,409,854 D840E possibly damaging Het
Trpc3 T A 3: 36,662,758 Y377F possibly damaging Het
Uba6 C T 5: 86,124,403 R778K probably benign Het
Vmn2r101 A T 17: 19,588,884 I92F probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r70 G T 7: 85,566,097 F76L probably benign Het
Vwa3b A G 1: 37,063,642 probably benign Het
Zfp407 T A 18: 84,560,349 T880S probably damaging Het
Zfp64 C A 2: 168,894,077 G560V probably benign Het
Other mutations in 1700122O11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02830:1700122O11Rik APN 17 48037426 missense possibly damaging 0.46
IGL02927:1700122O11Rik APN 17 48036920 nonsense probably null
R2013:1700122O11Rik UTSW 17 48036914 missense possibly damaging 0.53
R2014:1700122O11Rik UTSW 17 48036914 missense possibly damaging 0.53
R4698:1700122O11Rik UTSW 17 48038240 missense possibly damaging 0.46
R5194:1700122O11Rik UTSW 17 48037250 missense probably benign
R6352:1700122O11Rik UTSW 17 48037136 missense probably benign 0.08
R7546:1700122O11Rik UTSW 17 48037521 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGAGGAACCTGACCTATG -3'
(R):5'- TCTAGCTGGCTAAGAAACCAGC -3'

Sequencing Primer
(F):5'- GGAGGAACCTGACCTATGTTTCAATC -3'
(R):5'- TGGCTAAGAAACCAGCCTCTGATG -3'
Posted On2018-06-06