Mutagenetix > Incidental Mutations

Incidental Mutation 'R6513:Aox4'

519977

Institutional Source

Beutler Lab

Gene Symbol

Aox4

Ensembl Gene

ENSMUSG00000038242

Gene Name

aldehyde oxidase 4

Synonyms

2310003G12Rik, AOH2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6513 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58210397-58268597 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58213053 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 29 (N29S)

Ref Sequence

ENSEMBL: ENSMUSP00000048929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040442]

Predicted Effect

probably benign
Transcript: ENSMUST00000040442
AA Change: N29S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000048929
Gene: ENSMUSG00000038242
AA Change: N29S

Domain	Start	End	E-Value	Type
Pfam:Fer2	12	82	1.6e-10	PFAM
Pfam:Fer2_2	91	165	4.6e-30	PFAM
Pfam:FAD_binding_5	240	421	2.7e-47	PFAM
CO_deh_flav_C	428	532	1.19e-26	SMART
Ald_Xan_dh_C	596	699	8.22e-39	SMART
Pfam:Ald_Xan_dh_C2	709	1243	1.1e-178	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159240

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161833

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189059

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

98% (62/63)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit a slight decrease in prenatal survival and epidermal thickening that is exacerbated by UV treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438H23Rik	T	C	16: 91,055,766	S161G	probably benign	Het
Ankfy1	G	A	11: 72,730,482	R198Q	possibly damaging	Het
Ankrd11	A	G	8: 122,890,180	V2290A	probably benign	Het
Arhgap17	T	C	7: 123,292,156	R592G	possibly damaging	Het
BC027072	T	A	17: 71,744,706	E1217V	probably damaging	Het
C87414	C	A	5: 93,637,532		probably null	Het
Caap1	A	T	4: 94,501,403	D231E	possibly damaging	Het
Cabp1	T	A	5: 115,169,134	M165L	possibly damaging	Het
Cep72	A	T	13: 74,058,463	L73H	probably damaging	Het
Cfap74	A	G	4: 155,441,286	S731G	probably null	Het
Dsc2	T	C	18: 20,046,238	I258V	probably benign	Het
Dsg1c	T	G	18: 20,274,630	N344K	probably benign	Het
Enah	A	G	1: 182,014,355		probably benign	Het
Fam26d	T	A	10: 34,041,634	R274*	probably null	Het
Fbn1	T	A	2: 125,383,671	S554C	probably damaging	Het
Fkrp	C	A	7: 16,811,112	R275L	possibly damaging	Het
Gbp4	C	T	5: 105,123,120	G215D	possibly damaging	Het
Gli2	G	A	1: 118,855,554	L239F	probably damaging	Het
Gpr146	A	G	5: 139,392,818	D125G	probably damaging	Het
Hectd4	C	A	5: 121,356,196		probably null	Het
Invs	G	A	4: 48,397,534	V370I	possibly damaging	Het
Kdm2b	A	G	5: 122,880,239	V1040A	probably damaging	Het
Kidins220	T	A	12: 25,038,435	V1059D	possibly damaging	Het
Kif1bp	T	C	10: 62,575,034		probably null	Het
Kif26a	T	A	12: 112,175,492	S727T	probably damaging	Het
Klk1b27	A	G	7: 44,055,745	H112R	probably benign	Het
Krt72	T	G	15: 101,776,752		probably null	Het
Lactb	C	T	9: 66,970,890	R219H	probably damaging	Het
Lrig2	A	T	3: 104,465,729	I612N	probably damaging	Het
Meaf6	A	C	4: 125,089,904	N51T	probably damaging	Het
Mtap	A	G	4: 89,148,261	T36A	possibly damaging	Het
Myo3a	G	A	2: 22,407,332	G713S	probably damaging	Het
Nr4a3	C	T	4: 48,083,255	T596I	probably damaging	Het
Olfr1306	C	G	2: 111,912,883	G16R	possibly damaging	Het
Olfr1338	A	T	4: 118,754,027	C172*	probably null	Het
Pam	A	G	1: 97,838,027	V759A	possibly damaging	Het
Pds5a	T	A	5: 65,615,601	I1220F	probably benign	Het
Phldb2	T	A	16: 45,747,877	M1222L	possibly damaging	Het
Phospho1	C	T	11: 95,830,687	A61V	possibly damaging	Het
Pnpla7	G	A	2: 25,016,538	V638I	possibly damaging	Het
Ptf1a	T	A	2: 19,447,037	D282E	probably damaging	Het
Ptgs2	A	T	1: 150,100,128		probably benign	Het
Racgap1	T	C	15: 99,624,275	R471G	probably damaging	Het
Rptn	T	C	3: 93,396,112	S251P	possibly damaging	Het
Shcbp1	T	C	8: 4,744,507	M429V	probably benign	Het
Shprh	T	C	10: 11,186,893	L1248P	probably damaging	Het
Son	T	C	16: 91,659,947		probably benign	Het
Sppl3	T	C	5: 115,095,936	L355P	probably damaging	Het
Tbc1d31	A	T	15: 57,955,382	R794W	probably damaging	Het
Telo2	T	C	17: 25,101,412	Y766C	probably damaging	Het
Tfr2	A	G	5: 137,574,531		probably null	Het
Tle4	T	C	19: 14,451,692	D722G	probably damaging	Het
Tprgl	A	G	4: 154,159,405	V98A	probably benign	Het
Trak1	C	T	9: 121,443,756	R237C	probably benign	Het
Vmn2r113	T	C	17: 22,958,741	I833T	probably damaging	Het
Vmn2r118	T	A	17: 55,608,093	S518C	probably damaging	Het
Vmn2r49	A	G	7: 9,976,597	I736T	probably damaging	Het
Wdr38	T	A	2: 38,999,958		probably null	Het
Wee2	A	G	6: 40,452,619	E180G	probably benign	Het
Zbtb1	T	C	12: 76,385,830	S197P	possibly damaging	Het
Zc3h7a	T	C	16: 11,158,765		probably null	Het
Zfp516	T	A	18: 82,955,710	L11Q	probably damaging	Het
Zfp623	G	A	15: 75,947,468	R91H	probably benign	Het
Zkscan7	G	A	9: 122,896,105	R713Q	probably benign	Het

Other mutations in Aox4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Aox4	APN	1	58239174	missense	probably damaging	1.00
IGL01011:Aox4	APN	1	58240775	nonsense	probably null
IGL01634:Aox4	APN	1	58221930	missense	possibly damaging	0.81
IGL01689:Aox4	APN	1	58245161	splice site	probably benign
IGL01874:Aox4	APN	1	58252084	missense	probably damaging	1.00
IGL02104:Aox4	APN	1	58236657	splice site	probably benign
IGL02744:Aox4	APN	1	58255552	missense	possibly damaging	0.90
IGL02751:Aox4	APN	1	58259052	missense	probably damaging	1.00
IGL03225:Aox4	APN	1	58247227	missense	possibly damaging	0.94
IGL03247:Aox4	APN	1	58264367	missense	probably damaging	1.00
IGL03369:Aox4	APN	1	58262587	missense	probably benign	0.01
BB008:Aox4	UTSW	1	58255486	missense	probably benign	0.07
BB018:Aox4	UTSW	1	58255486	missense	probably benign	0.07
R0138:Aox4	UTSW	1	58228866	missense	probably damaging	1.00
R0243:Aox4	UTSW	1	58213076	missense	probably benign
R0368:Aox4	UTSW	1	58213079	missense	probably benign	0.07
R0499:Aox4	UTSW	1	58263397	critical splice donor site	probably null
R0513:Aox4	UTSW	1	58217519	missense	probably benign
R0513:Aox4	UTSW	1	58247300	missense	probably damaging	1.00
R0546:Aox4	UTSW	1	58250174	missense	probably damaging	1.00
R0591:Aox4	UTSW	1	58239102	splice site	probably benign
R0825:Aox4	UTSW	1	58248909	missense	possibly damaging	0.55
R1912:Aox4	UTSW	1	58264402	missense	probably damaging	1.00
R1934:Aox4	UTSW	1	58245936	missense	probably benign	0.01
R2180:Aox4	UTSW	1	58213067	missense	probably benign	0.00
R2293:Aox4	UTSW	1	58221937	missense	probably damaging	0.99
R3017:Aox4	UTSW	1	58235204	missense	probably benign
R3744:Aox4	UTSW	1	58245870	missense	probably damaging	1.00
R3745:Aox4	UTSW	1	58245870	missense	probably damaging	1.00
R3830:Aox4	UTSW	1	58255511	missense	probably damaging	0.99
R3856:Aox4	UTSW	1	58253934	missense	probably damaging	1.00
R4214:Aox4	UTSW	1	58221892	missense	probably damaging	0.99
R4484:Aox4	UTSW	1	58262571	missense	probably damaging	1.00
R4706:Aox4	UTSW	1	58266787	missense	probably damaging	1.00
R4710:Aox4	UTSW	1	58255638	missense	probably damaging	1.00
R4729:Aox4	UTSW	1	58259077	nonsense	probably null
R4769:Aox4	UTSW	1	58259148	missense	probably null	1.00
R4809:Aox4	UTSW	1	58266649	missense	probably damaging	1.00
R4989:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5082:Aox4	UTSW	1	58231483	missense	possibly damaging	0.63
R5102:Aox4	UTSW	1	58240778	missense	probably damaging	1.00
R5114:Aox4	UTSW	1	58246286	missense	possibly damaging	0.89
R5133:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5134:Aox4	UTSW	1	58236676	missense	probably benign	0.00
R5185:Aox4	UTSW	1	58254318	missense	probably damaging	1.00
R5217:Aox4	UTSW	1	58246241	nonsense	probably null
R5426:Aox4	UTSW	1	58220094	missense	probably damaging	1.00
R5443:Aox4	UTSW	1	58233992	splice site	probably null
R5708:Aox4	UTSW	1	58245873	missense	possibly damaging	0.69
R6052:Aox4	UTSW	1	58254318	nonsense	probably null
R6167:Aox4	UTSW	1	58263935	missense	probably damaging	1.00
R6179:Aox4	UTSW	1	58231503	missense	probably benign
R6196:Aox4	UTSW	1	58217526	missense	probably damaging	1.00
R6781:Aox4	UTSW	1	58245109	missense	probably benign	0.03
R6885:Aox4	UTSW	1	58264378	missense	probably damaging	1.00
R7082:Aox4	UTSW	1	58224193	missense	possibly damaging	0.82
R7127:Aox4	UTSW	1	58228874	missense	probably benign	0.00
R7153:Aox4	UTSW	1	58250219	missense	probably damaging	0.99
R7371:Aox4	UTSW	1	58263854	missense	probably damaging	1.00
R7690:Aox4	UTSW	1	58263917	missense	probably damaging	1.00
R7745:Aox4	UTSW	1	58240707	missense	probably benign	0.01
R7752:Aox4	UTSW	1	58253948	missense	not run
R7767:Aox4	UTSW	1	58235207	missense	probably damaging	0.98
R7782:Aox4	UTSW	1	58231092	splice site	probably null
R7931:Aox4	UTSW	1	58255486	missense	probably benign	0.07
R7978:Aox4	UTSW	1	58235207	missense	probably damaging	0.98
R7982:Aox4	UTSW	1	58257241	missense	possibly damaging	0.81
R8316:Aox4	UTSW	1	58254311	missense	possibly damaging	0.69
R8361:Aox4	UTSW	1	58240839	missense	probably benign	0.03
X0021:Aox4	UTSW	1	58247295	nonsense	probably null
X0028:Aox4	UTSW	1	58254183	missense	probably damaging	0.99
Z1176:Aox4	UTSW	1	58246351	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- AACGTCACTGTTTCTTCAGACC -3'
(R):5'- TTGCTTACCTAGAGGGAACGC -3'

Sequencing Primer
(F):5'- CTTCAGACCTTTGGTTCCAAAAATC -3'
(R):5'- TGCCTCCCAAGTGCTAGGATTAAAG -3'

Posted On

2018-06-06