Mutagenetix > Incidental Mutations

Incidental Mutation 'R6513:Myo3a'

519983

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6513 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 22407332 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 713 (G713S)

Ref Sequence

ENSEMBL: ENSMUSP00000120573 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000044749
AA Change: G721S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: G721S

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000121055

Predicted Effect

probably damaging
Transcript: ENSMUST00000153002
AA Change: G713S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716
AA Change: G713S

Domain	Start	End	E-Value	Type
S_TKc	21	287	1.62e-91	SMART
MYSc	332	753	3.06e-35	SMART

Meta Mutation Damage Score

0.7727

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438H23Rik	T	C	16: 91,055,766	S161G	probably benign	Het
Ankfy1	G	A	11: 72,730,482	R198Q	possibly damaging	Het
Ankrd11	A	G	8: 122,890,180	V2290A	probably benign	Het
Aox4	A	G	1: 58,213,053	N29S	probably benign	Het
Arhgap17	T	C	7: 123,292,156	R592G	possibly damaging	Het
BC027072	T	A	17: 71,744,706	E1217V	probably damaging	Het
C87414	C	A	5: 93,637,532		probably null	Het
Caap1	A	T	4: 94,501,403	D231E	possibly damaging	Het
Cabp1	T	A	5: 115,169,134	M165L	possibly damaging	Het
Cep72	A	T	13: 74,058,463	L73H	probably damaging	Het
Cfap74	A	G	4: 155,441,286	S731G	probably null	Het
Dsc2	T	C	18: 20,046,238	I258V	probably benign	Het
Dsg1c	T	G	18: 20,274,630	N344K	probably benign	Het
Enah	A	G	1: 182,014,355		probably benign	Het
Fam26d	T	A	10: 34,041,634	R274*	probably null	Het
Fbn1	T	A	2: 125,383,671	S554C	probably damaging	Het
Fkrp	C	A	7: 16,811,112	R275L	possibly damaging	Het
Gbp4	C	T	5: 105,123,120	G215D	possibly damaging	Het
Gli2	G	A	1: 118,855,554	L239F	probably damaging	Het
Gpr146	A	G	5: 139,392,818	D125G	probably damaging	Het
Hectd4	C	A	5: 121,356,196		probably null	Het
Invs	G	A	4: 48,397,534	V370I	possibly damaging	Het
Kdm2b	A	G	5: 122,880,239	V1040A	probably damaging	Het
Kidins220	T	A	12: 25,038,435	V1059D	possibly damaging	Het
Kif1bp	T	C	10: 62,575,034		probably null	Het
Kif26a	T	A	12: 112,175,492	S727T	probably damaging	Het
Klk1b27	A	G	7: 44,055,745	H112R	probably benign	Het
Krt72	T	G	15: 101,776,752		probably null	Het
Lactb	C	T	9: 66,970,890	R219H	probably damaging	Het
Lrig2	A	T	3: 104,465,729	I612N	probably damaging	Het
Meaf6	A	C	4: 125,089,904	N51T	probably damaging	Het
Mtap	A	G	4: 89,148,261	T36A	possibly damaging	Het
Nr4a3	C	T	4: 48,083,255	T596I	probably damaging	Het
Olfr1306	C	G	2: 111,912,883	G16R	possibly damaging	Het
Olfr1338	A	T	4: 118,754,027	C172*	probably null	Het
Pam	A	G	1: 97,838,027	V759A	possibly damaging	Het
Pds5a	T	A	5: 65,615,601	I1220F	probably benign	Het
Phldb2	T	A	16: 45,747,877	M1222L	possibly damaging	Het
Phospho1	C	T	11: 95,830,687	A61V	possibly damaging	Het
Pnpla7	G	A	2: 25,016,538	V638I	possibly damaging	Het
Ptf1a	T	A	2: 19,447,037	D282E	probably damaging	Het
Ptgs2	A	T	1: 150,100,128		probably benign	Het
Racgap1	T	C	15: 99,624,275	R471G	probably damaging	Het
Rptn	T	C	3: 93,396,112	S251P	possibly damaging	Het
Shcbp1	T	C	8: 4,744,507	M429V	probably benign	Het
Shprh	T	C	10: 11,186,893	L1248P	probably damaging	Het
Son	T	C	16: 91,659,947		probably benign	Het
Sppl3	T	C	5: 115,095,936	L355P	probably damaging	Het
Tbc1d31	A	T	15: 57,955,382	R794W	probably damaging	Het
Telo2	T	C	17: 25,101,412	Y766C	probably damaging	Het
Tfr2	A	G	5: 137,574,531		probably null	Het
Tle4	T	C	19: 14,451,692	D722G	probably damaging	Het
Tprgl	A	G	4: 154,159,405	V98A	probably benign	Het
Trak1	C	T	9: 121,443,756	R237C	probably benign	Het
Vmn2r113	T	C	17: 22,958,741	I833T	probably damaging	Het
Vmn2r118	T	A	17: 55,608,093	S518C	probably damaging	Het
Vmn2r49	A	G	7: 9,976,597	I736T	probably damaging	Het
Wdr38	T	A	2: 38,999,958		probably null	Het
Wee2	A	G	6: 40,452,619	E180G	probably benign	Het
Zbtb1	T	C	12: 76,385,830	S197P	possibly damaging	Het
Zc3h7a	T	C	16: 11,158,765		probably null	Het
Zfp516	T	A	18: 82,955,710	L11Q	probably damaging	Het
Zfp623	G	A	15: 75,947,468	R91H	probably benign	Het
Zkscan7	G	A	9: 122,896,105	R713Q	probably benign	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8708:Myo3a	UTSW	2	22291796	splice site	probably benign
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9258:Myo3a	UTSW	2	22577533	missense	possibly damaging	0.60
R9436:Myo3a	UTSW	2	22407424	nonsense	probably null
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- CAAAGATGGGAGTGGGTTCTAC -3'
(R):5'- CCTTGTCTTTGAATGGTAAGGC -3'

Sequencing Primer
(F):5'- TGGGTTCTACAGTAAGGAAAATGCTG -3'
(R):5'- TCTTTGAATGGTAAGGCATGAAG -3'

Posted On

2018-06-06