Incidental Mutation 'R6513:Nr4a3'
ID519990
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6513 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48083255 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 596 (T596I)
Ref Sequence ENSEMBL: ENSMUSP00000030025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect probably damaging
Transcript: ENSMUST00000030025
AA Change: T596I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: T596I

DomainStartEndE-ValueType
Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect unknown
Transcript: ENSMUST00000153369
AA Change: T625I
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: T625I

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Meta Mutation Damage Score 0.0947 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,766 S161G probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ankrd11 A G 8: 122,890,180 V2290A probably benign Het
Aox4 A G 1: 58,213,053 N29S probably benign Het
Arhgap17 T C 7: 123,292,156 R592G possibly damaging Het
BC027072 T A 17: 71,744,706 E1217V probably damaging Het
C87414 C A 5: 93,637,532 probably null Het
Caap1 A T 4: 94,501,403 D231E possibly damaging Het
Cabp1 T A 5: 115,169,134 M165L possibly damaging Het
Cep72 A T 13: 74,058,463 L73H probably damaging Het
Cfap74 A G 4: 155,441,286 S731G probably null Het
Dsc2 T C 18: 20,046,238 I258V probably benign Het
Dsg1c T G 18: 20,274,630 N344K probably benign Het
Enah A G 1: 182,014,355 probably benign Het
Fam26d T A 10: 34,041,634 R274* probably null Het
Fbn1 T A 2: 125,383,671 S554C probably damaging Het
Fkrp C A 7: 16,811,112 R275L possibly damaging Het
Gbp4 C T 5: 105,123,120 G215D possibly damaging Het
Gli2 G A 1: 118,855,554 L239F probably damaging Het
Gpr146 A G 5: 139,392,818 D125G probably damaging Het
Hectd4 C A 5: 121,356,196 probably null Het
Invs G A 4: 48,397,534 V370I possibly damaging Het
Kdm2b A G 5: 122,880,239 V1040A probably damaging Het
Kidins220 T A 12: 25,038,435 V1059D possibly damaging Het
Kif1bp T C 10: 62,575,034 probably null Het
Kif26a T A 12: 112,175,492 S727T probably damaging Het
Klk1b27 A G 7: 44,055,745 H112R probably benign Het
Krt72 T G 15: 101,776,752 probably null Het
Lactb C T 9: 66,970,890 R219H probably damaging Het
Lrig2 A T 3: 104,465,729 I612N probably damaging Het
Meaf6 A C 4: 125,089,904 N51T probably damaging Het
Mtap A G 4: 89,148,261 T36A possibly damaging Het
Myo3a G A 2: 22,407,332 G713S probably damaging Het
Olfr1306 C G 2: 111,912,883 G16R possibly damaging Het
Olfr1338 A T 4: 118,754,027 C172* probably null Het
Pam A G 1: 97,838,027 V759A possibly damaging Het
Pds5a T A 5: 65,615,601 I1220F probably benign Het
Phldb2 T A 16: 45,747,877 M1222L possibly damaging Het
Phospho1 C T 11: 95,830,687 A61V possibly damaging Het
Pnpla7 G A 2: 25,016,538 V638I possibly damaging Het
Ptf1a T A 2: 19,447,037 D282E probably damaging Het
Ptgs2 A T 1: 150,100,128 probably benign Het
Racgap1 T C 15: 99,624,275 R471G probably damaging Het
Rptn T C 3: 93,396,112 S251P possibly damaging Het
Shcbp1 T C 8: 4,744,507 M429V probably benign Het
Shprh T C 10: 11,186,893 L1248P probably damaging Het
Son T C 16: 91,659,947 probably benign Het
Sppl3 T C 5: 115,095,936 L355P probably damaging Het
Tbc1d31 A T 15: 57,955,382 R794W probably damaging Het
Telo2 T C 17: 25,101,412 Y766C probably damaging Het
Tfr2 A G 5: 137,574,531 probably null Het
Tle4 T C 19: 14,451,692 D722G probably damaging Het
Tprgl A G 4: 154,159,405 V98A probably benign Het
Trak1 C T 9: 121,443,756 R237C probably benign Het
Vmn2r113 T C 17: 22,958,741 I833T probably damaging Het
Vmn2r118 T A 17: 55,608,093 S518C probably damaging Het
Vmn2r49 A G 7: 9,976,597 I736T probably damaging Het
Wdr38 T A 2: 38,999,958 probably null Het
Wee2 A G 6: 40,452,619 E180G probably benign Het
Zbtb1 T C 12: 76,385,830 S197P possibly damaging Het
Zc3h7a T C 16: 11,158,765 probably null Het
Zfp516 T A 18: 82,955,710 L11Q probably damaging Het
Zfp623 G A 15: 75,947,468 R91H probably benign Het
Zkscan7 G A 9: 122,896,105 R713Q probably benign Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0486:Nr4a3 UTSW 4 48056525 splice site probably benign
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2016:Nr4a3 UTSW 4 48083252 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R2055:Nr4a3 UTSW 4 48067771 missense possibly damaging 0.86
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R3708:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4246:Nr4a3 UTSW 4 48083125 missense possibly damaging 0.86
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5539:Nr4a3 UTSW 4 48056525 splice site probably null
R5663:Nr4a3 UTSW 4 48055931 missense probably damaging 1.00
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6921:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R6940:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
R7659:Nr4a3 UTSW 4 48051269 missense probably damaging 1.00
R7895:Nr4a3 UTSW 4 48051390 missense probably benign
R7978:Nr4a3 UTSW 4 48051390 missense probably benign
R8022:Nr4a3 UTSW 4 48051510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCTGCTCCCAAACTTAC -3'
(R):5'- GCTTTTCCCCTGAAGGAAGG -3'

Sequencing Primer
(F):5'- TGCTCCCAAACTTACCAACTTC -3'
(R):5'- GTGGAAGGTGTTCAAACCCATTC -3'
Posted On2018-06-06