Incidental Mutation 'R6513:Tprgl'
ID519996
Institutional Source Beutler Lab
Gene Symbol Tprgl
Ensembl Gene ENSMUSG00000029030
Gene Nametransformation related protein 63 regulated like
Synonyms1200015A19Rik, mover
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6513 (G1)
Quality Score202.009
Status Validated
Chromosome4
Chromosomal Location154157485-154160666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154159405 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 98 (V98A)
Ref Sequence ENSEMBL: ENSMUSP00000101264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030895] [ENSMUST00000030896] [ENSMUST00000105639]
Predicted Effect probably benign
Transcript: ENSMUST00000030895
SMART Domains Protein: ENSMUSP00000030895
Gene: ENSMUSG00000029029

DomainStartEndE-ValueType
Blast:WD40 38 77 4e-18 BLAST
Blast:WD40 81 120 6e-16 BLAST
Blast:WD40 125 163 9e-6 BLAST
WD40 167 208 2.28e2 SMART
WD40 215 251 1.58e-2 SMART
WD40 319 360 2.29e1 SMART
WD40 363 401 4.18e-2 SMART
Blast:WD40 402 443 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000030896
AA Change: V157A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030896
Gene: ENSMUSG00000029030
AA Change: V157A

DomainStartEndE-ValueType
Pfam:hSac2 56 163 3.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105639
AA Change: V98A

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101264
Gene: ENSMUSG00000029030
AA Change: V98A

DomainStartEndE-ValueType
Pfam:hSac2 53 106 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142665
Predicted Effect probably benign
Transcript: ENSMUST00000146734
SMART Domains Protein: ENSMUSP00000118548
Gene: ENSMUSG00000029029

DomainStartEndE-ValueType
WD40 28 64 1.58e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,766 S161G probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ankrd11 A G 8: 122,890,180 V2290A probably benign Het
Aox4 A G 1: 58,213,053 N29S probably benign Het
Arhgap17 T C 7: 123,292,156 R592G possibly damaging Het
BC027072 T A 17: 71,744,706 E1217V probably damaging Het
C87414 C A 5: 93,637,532 probably null Het
Caap1 A T 4: 94,501,403 D231E possibly damaging Het
Cabp1 T A 5: 115,169,134 M165L possibly damaging Het
Cep72 A T 13: 74,058,463 L73H probably damaging Het
Cfap74 A G 4: 155,441,286 S731G probably null Het
Dsc2 T C 18: 20,046,238 I258V probably benign Het
Dsg1c T G 18: 20,274,630 N344K probably benign Het
Enah A G 1: 182,014,355 probably benign Het
Fam26d T A 10: 34,041,634 R274* probably null Het
Fbn1 T A 2: 125,383,671 S554C probably damaging Het
Fkrp C A 7: 16,811,112 R275L possibly damaging Het
Gbp4 C T 5: 105,123,120 G215D possibly damaging Het
Gli2 G A 1: 118,855,554 L239F probably damaging Het
Gpr146 A G 5: 139,392,818 D125G probably damaging Het
Hectd4 C A 5: 121,356,196 probably null Het
Invs G A 4: 48,397,534 V370I possibly damaging Het
Kdm2b A G 5: 122,880,239 V1040A probably damaging Het
Kidins220 T A 12: 25,038,435 V1059D possibly damaging Het
Kif1bp T C 10: 62,575,034 probably null Het
Kif26a T A 12: 112,175,492 S727T probably damaging Het
Klk1b27 A G 7: 44,055,745 H112R probably benign Het
Krt72 T G 15: 101,776,752 probably null Het
Lactb C T 9: 66,970,890 R219H probably damaging Het
Lrig2 A T 3: 104,465,729 I612N probably damaging Het
Meaf6 A C 4: 125,089,904 N51T probably damaging Het
Mtap A G 4: 89,148,261 T36A possibly damaging Het
Myo3a G A 2: 22,407,332 G713S probably damaging Het
Nr4a3 C T 4: 48,083,255 T596I probably damaging Het
Olfr1306 C G 2: 111,912,883 G16R possibly damaging Het
Olfr1338 A T 4: 118,754,027 C172* probably null Het
Pam A G 1: 97,838,027 V759A possibly damaging Het
Pds5a T A 5: 65,615,601 I1220F probably benign Het
Phldb2 T A 16: 45,747,877 M1222L possibly damaging Het
Phospho1 C T 11: 95,830,687 A61V possibly damaging Het
Pnpla7 G A 2: 25,016,538 V638I possibly damaging Het
Ptf1a T A 2: 19,447,037 D282E probably damaging Het
Ptgs2 A T 1: 150,100,128 probably benign Het
Racgap1 T C 15: 99,624,275 R471G probably damaging Het
Rptn T C 3: 93,396,112 S251P possibly damaging Het
Shcbp1 T C 8: 4,744,507 M429V probably benign Het
Shprh T C 10: 11,186,893 L1248P probably damaging Het
Son T C 16: 91,659,947 probably benign Het
Sppl3 T C 5: 115,095,936 L355P probably damaging Het
Tbc1d31 A T 15: 57,955,382 R794W probably damaging Het
Telo2 T C 17: 25,101,412 Y766C probably damaging Het
Tfr2 A G 5: 137,574,531 probably null Het
Tle4 T C 19: 14,451,692 D722G probably damaging Het
Trak1 C T 9: 121,443,756 R237C probably benign Het
Vmn2r113 T C 17: 22,958,741 I833T probably damaging Het
Vmn2r118 T A 17: 55,608,093 S518C probably damaging Het
Vmn2r49 A G 7: 9,976,597 I736T probably damaging Het
Wdr38 T A 2: 38,999,958 probably null Het
Wee2 A G 6: 40,452,619 E180G probably benign Het
Zbtb1 T C 12: 76,385,830 S197P possibly damaging Het
Zc3h7a T C 16: 11,158,765 probably null Het
Zfp516 T A 18: 82,955,710 L11Q probably damaging Het
Zfp623 G A 15: 75,947,468 R91H probably benign Het
Zkscan7 G A 9: 122,896,105 R713Q probably benign Het
Other mutations in Tprgl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Tprgl APN 4 154158433 missense probably damaging 1.00
R0025:Tprgl UTSW 4 154160345 splice site probably benign
R0037:Tprgl UTSW 4 154160137 missense possibly damaging 0.55
R0321:Tprgl UTSW 4 154159355 missense probably damaging 1.00
R1664:Tprgl UTSW 4 154159405 missense possibly damaging 0.74
R3737:Tprgl UTSW 4 154160128 missense probably benign 0.34
R6056:Tprgl UTSW 4 154160095 missense probably damaging 1.00
R7289:Tprgl UTSW 4 154160574 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGTTCTTAAACAGCACCACCTAGC -3'
(R):5'- ATAGGCTGCAAAGGAGGCTC -3'

Sequencing Primer
(F):5'- TACTGTGGAACTGCACCTCCAG -3'
(R):5'- CTGCAAAGGAGGCTCATTAACTTG -3'
Posted On2018-06-06