Incidental Mutation 'R6513:Fkrp'
ID520008
Institutional Source Beutler Lab
Gene Symbol Fkrp
Ensembl Gene ENSMUSG00000048920
Gene Namefukutin related protein
SynonymsA830029B19Rik, MDC1C, LGMD1I
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6513 (G1)
Quality Score129.008
Status Validated
Chromosome7
Chromosomal Location16809246-16816732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 16811112 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 275 (R275L)
Ref Sequence ENSEMBL: ENSMUSP00000059091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019220] [ENSMUST00000061390] [ENSMUST00000206259]
Predicted Effect probably benign
Transcript: ENSMUST00000019220
SMART Domains Protein: ENSMUSP00000019220
Gene: ENSMUSG00000030374

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 193 1.2e-44 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
WD40 434 473 5.72e-9 SMART
WD40 487 526 6.53e-4 SMART
WD40 540 579 6.99e-13 SMART
WD40 584 626 2.38e1 SMART
WD40 629 672 3.55e1 SMART
WD40 675 714 5.34e-9 SMART
WD40 717 760 1.58e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000061390
AA Change: R275L

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059091
Gene: ENSMUSG00000048920
AA Change: R275L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Pfam:LicD 334 374 1.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205677
Predicted Effect probably benign
Transcript: ENSMUST00000206259
Meta Mutation Damage Score 0.3447 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is targeted to the medial Golgi apparatus and is necessary for posttranslational modification of dystroglycan. Mutations in this gene have been associated with congenital muscular dystrophy, mental retardation, and cerebellar cysts. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die by E10.5. Mice homozygous for a knock-in allele exhibit a progressive muscular dystrophy phenotype, abnormal brain morphology, defecting neuron migration, reduced body weight, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,766 S161G probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ankrd11 A G 8: 122,890,180 V2290A probably benign Het
Aox4 A G 1: 58,213,053 N29S probably benign Het
Arhgap17 T C 7: 123,292,156 R592G possibly damaging Het
BC027072 T A 17: 71,744,706 E1217V probably damaging Het
C87414 C A 5: 93,637,532 probably null Het
Caap1 A T 4: 94,501,403 D231E possibly damaging Het
Cabp1 T A 5: 115,169,134 M165L possibly damaging Het
Cep72 A T 13: 74,058,463 L73H probably damaging Het
Cfap74 A G 4: 155,441,286 S731G probably null Het
Dsc2 T C 18: 20,046,238 I258V probably benign Het
Dsg1c T G 18: 20,274,630 N344K probably benign Het
Enah A G 1: 182,014,355 probably benign Het
Fam26d T A 10: 34,041,634 R274* probably null Het
Fbn1 T A 2: 125,383,671 S554C probably damaging Het
Gbp4 C T 5: 105,123,120 G215D possibly damaging Het
Gli2 G A 1: 118,855,554 L239F probably damaging Het
Gpr146 A G 5: 139,392,818 D125G probably damaging Het
Hectd4 C A 5: 121,356,196 probably null Het
Invs G A 4: 48,397,534 V370I possibly damaging Het
Kdm2b A G 5: 122,880,239 V1040A probably damaging Het
Kidins220 T A 12: 25,038,435 V1059D possibly damaging Het
Kif1bp T C 10: 62,575,034 probably null Het
Kif26a T A 12: 112,175,492 S727T probably damaging Het
Klk1b27 A G 7: 44,055,745 H112R probably benign Het
Krt72 T G 15: 101,776,752 probably null Het
Lactb C T 9: 66,970,890 R219H probably damaging Het
Lrig2 A T 3: 104,465,729 I612N probably damaging Het
Meaf6 A C 4: 125,089,904 N51T probably damaging Het
Mtap A G 4: 89,148,261 T36A possibly damaging Het
Myo3a G A 2: 22,407,332 G713S probably damaging Het
Nr4a3 C T 4: 48,083,255 T596I probably damaging Het
Olfr1306 C G 2: 111,912,883 G16R possibly damaging Het
Olfr1338 A T 4: 118,754,027 C172* probably null Het
Pam A G 1: 97,838,027 V759A possibly damaging Het
Pds5a T A 5: 65,615,601 I1220F probably benign Het
Phldb2 T A 16: 45,747,877 M1222L possibly damaging Het
Phospho1 C T 11: 95,830,687 A61V possibly damaging Het
Pnpla7 G A 2: 25,016,538 V638I possibly damaging Het
Ptf1a T A 2: 19,447,037 D282E probably damaging Het
Ptgs2 A T 1: 150,100,128 probably benign Het
Racgap1 T C 15: 99,624,275 R471G probably damaging Het
Rptn T C 3: 93,396,112 S251P possibly damaging Het
Shcbp1 T C 8: 4,744,507 M429V probably benign Het
Shprh T C 10: 11,186,893 L1248P probably damaging Het
Son T C 16: 91,659,947 probably benign Het
Sppl3 T C 5: 115,095,936 L355P probably damaging Het
Tbc1d31 A T 15: 57,955,382 R794W probably damaging Het
Telo2 T C 17: 25,101,412 Y766C probably damaging Het
Tfr2 A G 5: 137,574,531 probably null Het
Tle4 T C 19: 14,451,692 D722G probably damaging Het
Tprgl A G 4: 154,159,405 V98A probably benign Het
Trak1 C T 9: 121,443,756 R237C probably benign Het
Vmn2r113 T C 17: 22,958,741 I833T probably damaging Het
Vmn2r118 T A 17: 55,608,093 S518C probably damaging Het
Vmn2r49 A G 7: 9,976,597 I736T probably damaging Het
Wdr38 T A 2: 38,999,958 probably null Het
Wee2 A G 6: 40,452,619 E180G probably benign Het
Zbtb1 T C 12: 76,385,830 S197P possibly damaging Het
Zc3h7a T C 16: 11,158,765 probably null Het
Zfp516 T A 18: 82,955,710 L11Q probably damaging Het
Zfp623 G A 15: 75,947,468 R91H probably benign Het
Zkscan7 G A 9: 122,896,105 R713Q probably benign Het
Other mutations in Fkrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Fkrp APN 7 16811490 missense probably benign 0.02
R1177:Fkrp UTSW 7 16810527 missense probably damaging 1.00
R1722:Fkrp UTSW 7 16810794 missense probably benign 0.20
R1984:Fkrp UTSW 7 16811877 missense probably benign 0.11
R2519:Fkrp UTSW 7 16810952 nonsense probably null
R5227:Fkrp UTSW 7 16810710 missense possibly damaging 0.95
R5566:Fkrp UTSW 7 16810924 missense probably damaging 1.00
R6939:Fkrp UTSW 7 16811826 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCCAGATCTACGTCGTAG -3'
(R):5'- TAGCTCTGAACGTCAGCCTG -3'

Sequencing Primer
(F):5'- AGATCTACGTCGTAGTCCCAAGG -3'
(R):5'- ACGCTGTGCTGCTGATGC -3'
Posted On2018-06-06