Incidental Mutation 'R6513:Shcbp1'
ID520011
Institutional Source Beutler Lab
Gene Symbol Shcbp1
Ensembl Gene ENSMUSG00000022322
Gene NameShc SH2-domain binding protein 1
SynonymsmPAL
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6513 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location4735976-4779567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4744507 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 429 (M429V)
Ref Sequence ENSEMBL: ENSMUSP00000022945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022945]
Predicted Effect probably benign
Transcript: ENSMUST00000022945
AA Change: M429V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022945
Gene: ENSMUSG00000022322
AA Change: M429V

DomainStartEndE-ValueType
low complexity region 210 219 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
PbH1 428 451 8.61e3 SMART
PbH1 452 473 2.38e3 SMART
PbH1 474 496 9.62e2 SMART
PbH1 497 518 1.07e2 SMART
PbH1 526 548 1.74e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207665
Predicted Effect probably benign
Transcript: ENSMUST00000207876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208856
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal viability, fertility and T cell development but show decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,766 S161G probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ankrd11 A G 8: 122,890,180 V2290A probably benign Het
Aox4 A G 1: 58,213,053 N29S probably benign Het
Arhgap17 T C 7: 123,292,156 R592G possibly damaging Het
BC027072 T A 17: 71,744,706 E1217V probably damaging Het
C87414 C A 5: 93,637,532 probably null Het
Caap1 A T 4: 94,501,403 D231E possibly damaging Het
Cabp1 T A 5: 115,169,134 M165L possibly damaging Het
Cep72 A T 13: 74,058,463 L73H probably damaging Het
Cfap74 A G 4: 155,441,286 S731G probably null Het
Dsc2 T C 18: 20,046,238 I258V probably benign Het
Dsg1c T G 18: 20,274,630 N344K probably benign Het
Enah A G 1: 182,014,355 probably benign Het
Fam26d T A 10: 34,041,634 R274* probably null Het
Fbn1 T A 2: 125,383,671 S554C probably damaging Het
Fkrp C A 7: 16,811,112 R275L possibly damaging Het
Gbp4 C T 5: 105,123,120 G215D possibly damaging Het
Gli2 G A 1: 118,855,554 L239F probably damaging Het
Gpr146 A G 5: 139,392,818 D125G probably damaging Het
Hectd4 C A 5: 121,356,196 probably null Het
Invs G A 4: 48,397,534 V370I possibly damaging Het
Kdm2b A G 5: 122,880,239 V1040A probably damaging Het
Kidins220 T A 12: 25,038,435 V1059D possibly damaging Het
Kif1bp T C 10: 62,575,034 probably null Het
Kif26a T A 12: 112,175,492 S727T probably damaging Het
Klk1b27 A G 7: 44,055,745 H112R probably benign Het
Krt72 T G 15: 101,776,752 probably null Het
Lactb C T 9: 66,970,890 R219H probably damaging Het
Lrig2 A T 3: 104,465,729 I612N probably damaging Het
Meaf6 A C 4: 125,089,904 N51T probably damaging Het
Mtap A G 4: 89,148,261 T36A possibly damaging Het
Myo3a G A 2: 22,407,332 G713S probably damaging Het
Nr4a3 C T 4: 48,083,255 T596I probably damaging Het
Olfr1306 C G 2: 111,912,883 G16R possibly damaging Het
Olfr1338 A T 4: 118,754,027 C172* probably null Het
Pam A G 1: 97,838,027 V759A possibly damaging Het
Pds5a T A 5: 65,615,601 I1220F probably benign Het
Phldb2 T A 16: 45,747,877 M1222L possibly damaging Het
Phospho1 C T 11: 95,830,687 A61V possibly damaging Het
Pnpla7 G A 2: 25,016,538 V638I possibly damaging Het
Ptf1a T A 2: 19,447,037 D282E probably damaging Het
Ptgs2 A T 1: 150,100,128 probably benign Het
Racgap1 T C 15: 99,624,275 R471G probably damaging Het
Rptn T C 3: 93,396,112 S251P possibly damaging Het
Shprh T C 10: 11,186,893 L1248P probably damaging Het
Son T C 16: 91,659,947 probably benign Het
Sppl3 T C 5: 115,095,936 L355P probably damaging Het
Tbc1d31 A T 15: 57,955,382 R794W probably damaging Het
Telo2 T C 17: 25,101,412 Y766C probably damaging Het
Tfr2 A G 5: 137,574,531 probably null Het
Tle4 T C 19: 14,451,692 D722G probably damaging Het
Tprgl A G 4: 154,159,405 V98A probably benign Het
Trak1 C T 9: 121,443,756 R237C probably benign Het
Vmn2r113 T C 17: 22,958,741 I833T probably damaging Het
Vmn2r118 T A 17: 55,608,093 S518C probably damaging Het
Vmn2r49 A G 7: 9,976,597 I736T probably damaging Het
Wdr38 T A 2: 38,999,958 probably null Het
Wee2 A G 6: 40,452,619 E180G probably benign Het
Zbtb1 T C 12: 76,385,830 S197P possibly damaging Het
Zc3h7a T C 16: 11,158,765 probably null Het
Zfp516 T A 18: 82,955,710 L11Q probably damaging Het
Zfp623 G A 15: 75,947,468 R91H probably benign Het
Zkscan7 G A 9: 122,896,105 R713Q probably benign Het
Other mutations in Shcbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Shcbp1 APN 8 4754258 nonsense probably null
IGL01330:Shcbp1 APN 8 4736372 missense probably benign 0.00
IGL01878:Shcbp1 APN 8 4749721 missense probably damaging 0.98
IGL02415:Shcbp1 APN 8 4754239 missense possibly damaging 0.93
IGL02559:Shcbp1 APN 8 4749305 missense probably damaging 0.98
IGL03171:Shcbp1 APN 8 4739166 missense probably benign 0.05
IGL03348:Shcbp1 APN 8 4765089 missense probably benign 0.10
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0729:Shcbp1 UTSW 8 4736297 missense probably benign 0.05
R0743:Shcbp1 UTSW 8 4764906 missense probably benign
R1413:Shcbp1 UTSW 8 4741968 critical splice acceptor site probably null
R1630:Shcbp1 UTSW 8 4748763 nonsense probably null
R1645:Shcbp1 UTSW 8 4749645 missense probably benign 0.00
R3778:Shcbp1 UTSW 8 4736295 missense probably benign 0.01
R4066:Shcbp1 UTSW 8 4748716 missense probably damaging 0.98
R4232:Shcbp1 UTSW 8 4736372 missense probably benign 0.06
R4524:Shcbp1 UTSW 8 4739193 missense probably damaging 1.00
R4552:Shcbp1 UTSW 8 4749779 nonsense probably null
R4623:Shcbp1 UTSW 8 4739178 missense probably damaging 1.00
R4748:Shcbp1 UTSW 8 4744512 missense probably damaging 1.00
R5093:Shcbp1 UTSW 8 4739214 missense possibly damaging 0.68
R5152:Shcbp1 UTSW 8 4736138 missense probably damaging 1.00
R5540:Shcbp1 UTSW 8 4744529 missense probably damaging 1.00
R5758:Shcbp1 UTSW 8 4749355 unclassified probably null
R5878:Shcbp1 UTSW 8 4748742 missense probably benign 0.04
R6062:Shcbp1 UTSW 8 4764905 missense probably benign 0.13
R6366:Shcbp1 UTSW 8 4749380 missense probably damaging 1.00
R6394:Shcbp1 UTSW 8 4736176 missense probably damaging 0.99
R6696:Shcbp1 UTSW 8 4739262 missense probably damaging 1.00
R7014:Shcbp1 UTSW 8 4754234 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4741876 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4754310 missense probably damaging 1.00
R7420:Shcbp1 UTSW 8 4748737 missense probably benign 0.02
R7710:Shcbp1 UTSW 8 4764965 missense probably benign 0.14
R7720:Shcbp1 UTSW 8 4748720 missense probably damaging 1.00
X0062:Shcbp1 UTSW 8 4739249 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATACGAGTTATTAATCTGCCTCCC -3'
(R):5'- TGCTCCCTCTGACCATGAAATC -3'

Sequencing Primer
(F):5'- CTTTCATGCACAGTCGAC -3'
(R):5'- GTGGACCTAGGCTACTCTACTCAG -3'
Posted On2018-06-06