Incidental Mutation 'R6513:Zkscan7'
ID520015
Institutional Source Beutler Lab
Gene Symbol Zkscan7
Ensembl Gene ENSMUSG00000063488
Gene Namezinc finger with KRAB and SCAN domains 7
SynonymsZfp167
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6513 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location122885685-122898618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122896105 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 713 (R713Q)
Ref Sequence ENSEMBL: ENSMUSP00000071695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063980] [ENSMUST00000215872]
Predicted Effect probably benign
Transcript: ENSMUST00000063980
AA Change: R713Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000071695
Gene: ENSMUSG00000063488
AA Change: R713Q

DomainStartEndE-ValueType
SCAN 45 156 1.18e-65 SMART
ZnF_C2H2 350 372 5.59e-4 SMART
ZnF_C2H2 378 400 3.69e-4 SMART
ZnF_C2H2 434 456 8.4e1 SMART
ZnF_C2H2 487 509 4.24e-4 SMART
ZnF_C2H2 515 537 8.34e-3 SMART
ZnF_C2H2 543 565 7.37e-4 SMART
ZnF_C2H2 571 593 1.92e-2 SMART
ZnF_C2H2 599 621 1.13e-4 SMART
ZnF_C2H2 627 649 2.24e-3 SMART
ZnF_C2H2 655 677 4.17e-3 SMART
ZnF_C2H2 683 705 1.04e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214426
Predicted Effect probably benign
Transcript: ENSMUST00000215872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216924
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,766 S161G probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ankrd11 A G 8: 122,890,180 V2290A probably benign Het
Aox4 A G 1: 58,213,053 N29S probably benign Het
Arhgap17 T C 7: 123,292,156 R592G possibly damaging Het
BC027072 T A 17: 71,744,706 E1217V probably damaging Het
C87414 C A 5: 93,637,532 probably null Het
Caap1 A T 4: 94,501,403 D231E possibly damaging Het
Cabp1 T A 5: 115,169,134 M165L possibly damaging Het
Cep72 A T 13: 74,058,463 L73H probably damaging Het
Cfap74 A G 4: 155,441,286 S731G probably null Het
Dsc2 T C 18: 20,046,238 I258V probably benign Het
Dsg1c T G 18: 20,274,630 N344K probably benign Het
Enah A G 1: 182,014,355 probably benign Het
Fam26d T A 10: 34,041,634 R274* probably null Het
Fbn1 T A 2: 125,383,671 S554C probably damaging Het
Fkrp C A 7: 16,811,112 R275L possibly damaging Het
Gbp4 C T 5: 105,123,120 G215D possibly damaging Het
Gli2 G A 1: 118,855,554 L239F probably damaging Het
Gpr146 A G 5: 139,392,818 D125G probably damaging Het
Hectd4 C A 5: 121,356,196 probably null Het
Invs G A 4: 48,397,534 V370I possibly damaging Het
Kdm2b A G 5: 122,880,239 V1040A probably damaging Het
Kidins220 T A 12: 25,038,435 V1059D possibly damaging Het
Kif1bp T C 10: 62,575,034 probably null Het
Kif26a T A 12: 112,175,492 S727T probably damaging Het
Klk1b27 A G 7: 44,055,745 H112R probably benign Het
Krt72 T G 15: 101,776,752 probably null Het
Lactb C T 9: 66,970,890 R219H probably damaging Het
Lrig2 A T 3: 104,465,729 I612N probably damaging Het
Meaf6 A C 4: 125,089,904 N51T probably damaging Het
Mtap A G 4: 89,148,261 T36A possibly damaging Het
Myo3a G A 2: 22,407,332 G713S probably damaging Het
Nr4a3 C T 4: 48,083,255 T596I probably damaging Het
Olfr1306 C G 2: 111,912,883 G16R possibly damaging Het
Olfr1338 A T 4: 118,754,027 C172* probably null Het
Pam A G 1: 97,838,027 V759A possibly damaging Het
Pds5a T A 5: 65,615,601 I1220F probably benign Het
Phldb2 T A 16: 45,747,877 M1222L possibly damaging Het
Phospho1 C T 11: 95,830,687 A61V possibly damaging Het
Pnpla7 G A 2: 25,016,538 V638I possibly damaging Het
Ptf1a T A 2: 19,447,037 D282E probably damaging Het
Ptgs2 A T 1: 150,100,128 probably benign Het
Racgap1 T C 15: 99,624,275 R471G probably damaging Het
Rptn T C 3: 93,396,112 S251P possibly damaging Het
Shcbp1 T C 8: 4,744,507 M429V probably benign Het
Shprh T C 10: 11,186,893 L1248P probably damaging Het
Son T C 16: 91,659,947 probably benign Het
Sppl3 T C 5: 115,095,936 L355P probably damaging Het
Tbc1d31 A T 15: 57,955,382 R794W probably damaging Het
Telo2 T C 17: 25,101,412 Y766C probably damaging Het
Tfr2 A G 5: 137,574,531 probably null Het
Tle4 T C 19: 14,451,692 D722G probably damaging Het
Tprgl A G 4: 154,159,405 V98A probably benign Het
Trak1 C T 9: 121,443,756 R237C probably benign Het
Vmn2r113 T C 17: 22,958,741 I833T probably damaging Het
Vmn2r118 T A 17: 55,608,093 S518C probably damaging Het
Vmn2r49 A G 7: 9,976,597 I736T probably damaging Het
Wdr38 T A 2: 38,999,958 probably null Het
Wee2 A G 6: 40,452,619 E180G probably benign Het
Zbtb1 T C 12: 76,385,830 S197P possibly damaging Het
Zc3h7a T C 16: 11,158,765 probably null Het
Zfp516 T A 18: 82,955,710 L11Q probably damaging Het
Zfp623 G A 15: 75,947,468 R91H probably benign Het
Other mutations in Zkscan7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Zkscan7 APN 9 122895594 missense possibly damaging 0.95
IGL01650:Zkscan7 APN 9 122894827 missense probably benign
IGL01905:Zkscan7 APN 9 122890761 missense possibly damaging 0.93
IGL02466:Zkscan7 APN 9 122888885 missense probably damaging 0.98
R0310:Zkscan7 UTSW 9 122888893 nonsense probably null
R0355:Zkscan7 UTSW 9 122888807 missense probably damaging 1.00
R0477:Zkscan7 UTSW 9 122890809 splice site probably null
R1276:Zkscan7 UTSW 9 122890723 missense probably damaging 0.98
R1426:Zkscan7 UTSW 9 122895163 missense probably benign
R2055:Zkscan7 UTSW 9 122888937 missense probably damaging 1.00
R2195:Zkscan7 UTSW 9 122895621 missense possibly damaging 0.73
R2354:Zkscan7 UTSW 9 122894827 missense probably benign
R4878:Zkscan7 UTSW 9 122890800 nonsense probably null
R5106:Zkscan7 UTSW 9 122896133 unclassified probably benign
R6266:Zkscan7 UTSW 9 122895234 nonsense probably null
R6299:Zkscan7 UTSW 9 122888717 missense probably damaging 1.00
R6881:Zkscan7 UTSW 9 122888701 missense possibly damaging 0.96
R7640:Zkscan7 UTSW 9 122896056 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CGAGGCATTCATTTGGAATAAAAG -3'
(R):5'- AAGCACTCATTTGAAAGAGAATAAGA -3'

Sequencing Primer
(F):5'- GTTCATCAGAGAACCCATACTGGTG -3'
(R):5'- AAGACAAGGTTTCTCTGTGTACCC -3'
Posted On2018-06-06