Incidental Mutation 'R6513:Phospho1'
ID520020
Institutional Source Beutler Lab
Gene Symbol Phospho1
Ensembl Gene ENSMUSG00000050860
Gene Namephosphatase, orphan 1
SynonymsD11Moh36
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6513 (G1)
Quality Score212.009
Status Validated
Chromosome11
Chromosomal Location95824499-95832140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95830687 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 61 (A61V)
Ref Sequence ENSEMBL: ENSMUSP00000057858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054173] [ENSMUST00000059026] [ENSMUST00000133070] [ENSMUST00000150134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054173
AA Change: A61V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057858
Gene: ENSMUSG00000050860
AA Change: A61V

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 27 264 6.9e-103 PFAM
Pfam:HAD 29 211 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059026
SMART Domains Protein: ENSMUSP00000061893
Gene: ENSMUSG00000018381

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Abi_HHR 96 168 4.3e-31 PFAM
low complexity region 206 225 N/A INTRINSIC
low complexity region 233 252 N/A INTRINSIC
low complexity region 259 303 N/A INTRINSIC
SH3 312 367 1.41e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131049
Predicted Effect probably benign
Transcript: ENSMUST00000133070
SMART Domains Protein: ENSMUSP00000122280
Gene: ENSMUSG00000075595

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137645
SMART Domains Protein: ENSMUSP00000119990
Gene: ENSMUSG00000018381

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 49 8.8e-14 PFAM
low complexity region 87 106 N/A INTRINSIC
low complexity region 114 133 N/A INTRINSIC
low complexity region 140 183 N/A INTRINSIC
SH3 192 244 2.89e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150134
AA Change: A43V

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000176538
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit fractures, bowed long bones, osteomalacia, and scoliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,766 S161G probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ankrd11 A G 8: 122,890,180 V2290A probably benign Het
Aox4 A G 1: 58,213,053 N29S probably benign Het
Arhgap17 T C 7: 123,292,156 R592G possibly damaging Het
BC027072 T A 17: 71,744,706 E1217V probably damaging Het
C87414 C A 5: 93,637,532 probably null Het
Caap1 A T 4: 94,501,403 D231E possibly damaging Het
Cabp1 T A 5: 115,169,134 M165L possibly damaging Het
Cep72 A T 13: 74,058,463 L73H probably damaging Het
Cfap74 A G 4: 155,441,286 S731G probably null Het
Dsc2 T C 18: 20,046,238 I258V probably benign Het
Dsg1c T G 18: 20,274,630 N344K probably benign Het
Enah A G 1: 182,014,355 probably benign Het
Fam26d T A 10: 34,041,634 R274* probably null Het
Fbn1 T A 2: 125,383,671 S554C probably damaging Het
Fkrp C A 7: 16,811,112 R275L possibly damaging Het
Gbp4 C T 5: 105,123,120 G215D possibly damaging Het
Gli2 G A 1: 118,855,554 L239F probably damaging Het
Gpr146 A G 5: 139,392,818 D125G probably damaging Het
Hectd4 C A 5: 121,356,196 probably null Het
Invs G A 4: 48,397,534 V370I possibly damaging Het
Kdm2b A G 5: 122,880,239 V1040A probably damaging Het
Kidins220 T A 12: 25,038,435 V1059D possibly damaging Het
Kif1bp T C 10: 62,575,034 probably null Het
Kif26a T A 12: 112,175,492 S727T probably damaging Het
Klk1b27 A G 7: 44,055,745 H112R probably benign Het
Krt72 T G 15: 101,776,752 probably null Het
Lactb C T 9: 66,970,890 R219H probably damaging Het
Lrig2 A T 3: 104,465,729 I612N probably damaging Het
Meaf6 A C 4: 125,089,904 N51T probably damaging Het
Mtap A G 4: 89,148,261 T36A possibly damaging Het
Myo3a G A 2: 22,407,332 G713S probably damaging Het
Nr4a3 C T 4: 48,083,255 T596I probably damaging Het
Olfr1306 C G 2: 111,912,883 G16R possibly damaging Het
Olfr1338 A T 4: 118,754,027 C172* probably null Het
Pam A G 1: 97,838,027 V759A possibly damaging Het
Pds5a T A 5: 65,615,601 I1220F probably benign Het
Phldb2 T A 16: 45,747,877 M1222L possibly damaging Het
Pnpla7 G A 2: 25,016,538 V638I possibly damaging Het
Ptf1a T A 2: 19,447,037 D282E probably damaging Het
Ptgs2 A T 1: 150,100,128 probably benign Het
Racgap1 T C 15: 99,624,275 R471G probably damaging Het
Rptn T C 3: 93,396,112 S251P possibly damaging Het
Shcbp1 T C 8: 4,744,507 M429V probably benign Het
Shprh T C 10: 11,186,893 L1248P probably damaging Het
Son T C 16: 91,659,947 probably benign Het
Sppl3 T C 5: 115,095,936 L355P probably damaging Het
Tbc1d31 A T 15: 57,955,382 R794W probably damaging Het
Telo2 T C 17: 25,101,412 Y766C probably damaging Het
Tfr2 A G 5: 137,574,531 probably null Het
Tle4 T C 19: 14,451,692 D722G probably damaging Het
Tprgl A G 4: 154,159,405 V98A probably benign Het
Trak1 C T 9: 121,443,756 R237C probably benign Het
Vmn2r113 T C 17: 22,958,741 I833T probably damaging Het
Vmn2r118 T A 17: 55,608,093 S518C probably damaging Het
Vmn2r49 A G 7: 9,976,597 I736T probably damaging Het
Wdr38 T A 2: 38,999,958 probably null Het
Wee2 A G 6: 40,452,619 E180G probably benign Het
Zbtb1 T C 12: 76,385,830 S197P possibly damaging Het
Zc3h7a T C 16: 11,158,765 probably null Het
Zfp516 T A 18: 82,955,710 L11Q probably damaging Het
Zfp623 G A 15: 75,947,468 R91H probably benign Het
Zkscan7 G A 9: 122,896,105 R713Q probably benign Het
Other mutations in Phospho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Phospho1 APN 11 95831083 missense probably damaging 0.99
IGL01950:Phospho1 APN 11 95828722 unclassified probably benign
IGL02676:Phospho1 APN 11 95830888 missense probably damaging 1.00
R1965:Phospho1 UTSW 11 95830879 missense probably damaging 1.00
R2019:Phospho1 UTSW 11 95831106 missense probably damaging 0.99
R6160:Phospho1 UTSW 11 95830624 missense probably damaging 1.00
R7146:Phospho1 UTSW 11 95830906 missense probably damaging 1.00
R7652:Phospho1 UTSW 11 95830819 missense probably damaging 1.00
RF007:Phospho1 UTSW 11 95831055 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAATCAGCTTCTCCCTGG -3'
(R):5'- TCCGAAATGAGAATAACCTCGAAG -3'

Sequencing Primer
(F):5'- TTCTCCCTGGCCGGCTC -3'
(R):5'- TAACCTCGAAGCAGGAGCC -3'
Posted On2018-06-06