Mutagenetix > Incidental Mutation

Incidental Mutation 'R6513:Zbtb1'

520022

Institutional Source

Beutler Lab

Gene Symbol

Zbtb1

Ensembl Gene

ENSMUSG00000033454

Gene Name

zinc finger and BTB domain containing 1

Synonyms

C430003J21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.713) question?

Stock #

R6513 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76370266-76396950 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76385830 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 197 (S197P)

Ref Sequence

ENSEMBL: ENSMUSP00000041955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042779]

AlphaFold

Q91VL9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042779
AA Change: S197P

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000041955
Gene: ENSMUSG00000033454
AA Change: S197P

Domain	Start	End	E-Value	Type
BTB	24	121	1.01e-16	SMART
ZnF_C2H2	216	242	2.17e1	SMART
low complexity region	359	368	N/A	INTRINSIC
ZnF_C2H2	421	443	3.38e1	SMART
ZnF_C2H2	534	554	1.4e1	SMART
ZnF_C2H2	578	600	2.02e-1	SMART
ZnF_C2H2	606	628	6.23e-2	SMART
ZnF_C2H2	634	656	1.62e0	SMART
ZnF_C2H2	662	684	1.08e-1	SMART
ZnF_C2H2	686	709	1.36e-2	SMART

Meta Mutation Damage Score

0.0836

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

98% (62/63)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit abnormal thymus, B cell, and T cell differentiation, and reduced numbers of T, B, and NK cells in the spleen. [provided by MGI curators]

Allele List at MGI

www.informatics.jax.org/javawi2/servlet/WIFetch

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438H23Rik	T	C	16: 91,055,766	S161G	probably benign	Het
Ankfy1	G	A	11: 72,730,482	R198Q	possibly damaging	Het
Ankrd11	A	G	8: 122,890,180	V2290A	probably benign	Het
Aox4	A	G	1: 58,213,053	N29S	probably benign	Het
Arhgap17	T	C	7: 123,292,156	R592G	possibly damaging	Het
BC027072	T	A	17: 71,744,706	E1217V	probably damaging	Het
C87414	C	A	5: 93,637,532		probably null	Het
Caap1	A	T	4: 94,501,403	D231E	possibly damaging	Het
Cabp1	T	A	5: 115,169,134	M165L	possibly damaging	Het
Cep72	A	T	13: 74,058,463	L73H	probably damaging	Het
Cfap74	A	G	4: 155,441,286	S731G	probably null	Het
Dsc2	T	C	18: 20,046,238	I258V	probably benign	Het
Dsg1c	T	G	18: 20,274,630	N344K	probably benign	Het
Enah	A	G	1: 182,014,355		probably benign	Het
Fam26d	T	A	10: 34,041,634	R274*	probably null	Het
Fbn1	T	A	2: 125,383,671	S554C	probably damaging	Het
Fkrp	C	A	7: 16,811,112	R275L	possibly damaging	Het
Gbp4	C	T	5: 105,123,120	G215D	possibly damaging	Het
Gli2	G	A	1: 118,855,554	L239F	probably damaging	Het
Gpr146	A	G	5: 139,392,818	D125G	probably damaging	Het
Hectd4	C	A	5: 121,356,196		probably null	Het
Invs	G	A	4: 48,397,534	V370I	possibly damaging	Het
Kdm2b	A	G	5: 122,880,239	V1040A	probably damaging	Het
Kidins220	T	A	12: 25,038,435	V1059D	possibly damaging	Het
Kif1bp	T	C	10: 62,575,034		probably null	Het
Kif26a	T	A	12: 112,175,492	S727T	probably damaging	Het
Klk1b27	A	G	7: 44,055,745	H112R	probably benign	Het
Krt72	T	G	15: 101,776,752		probably null	Het
Lactb	C	T	9: 66,970,890	R219H	probably damaging	Het
Lrig2	A	T	3: 104,465,729	I612N	probably damaging	Het
Meaf6	A	C	4: 125,089,904	N51T	probably damaging	Het
Mtap	A	G	4: 89,148,261	T36A	possibly damaging	Het
Myo3a	G	A	2: 22,407,332	G713S	probably damaging	Het
Nr4a3	C	T	4: 48,083,255	T596I	probably damaging	Het
Olfr1306	C	G	2: 111,912,883	G16R	possibly damaging	Het
Olfr1338	A	T	4: 118,754,027	C172*	probably null	Het
Pam	A	G	1: 97,838,027	V759A	possibly damaging	Het
Pds5a	T	A	5: 65,615,601	I1220F	probably benign	Het
Phldb2	T	A	16: 45,747,877	M1222L	possibly damaging	Het
Phospho1	C	T	11: 95,830,687	A61V	possibly damaging	Het
Pnpla7	G	A	2: 25,016,538	V638I	possibly damaging	Het
Ptf1a	T	A	2: 19,447,037	D282E	probably damaging	Het
Ptgs2	A	T	1: 150,100,128		probably benign	Het
Racgap1	T	C	15: 99,624,275	R471G	probably damaging	Het
Rptn	T	C	3: 93,396,112	S251P	possibly damaging	Het
Shcbp1	T	C	8: 4,744,507	M429V	probably benign	Het
Shprh	T	C	10: 11,186,893	L1248P	probably damaging	Het
Son	T	C	16: 91,659,947		probably benign	Het
Sppl3	T	C	5: 115,095,936	L355P	probably damaging	Het
Tbc1d31	A	T	15: 57,955,382	R794W	probably damaging	Het
Telo2	T	C	17: 25,101,412	Y766C	probably damaging	Het
Tfr2	A	G	5: 137,574,531		probably null	Het
Tle4	T	C	19: 14,451,692	D722G	probably damaging	Het
Tprgl	A	G	4: 154,159,405	V98A	probably benign	Het
Trak1	C	T	9: 121,443,756	R237C	probably benign	Het
Vmn2r113	T	C	17: 22,958,741	I833T	probably damaging	Het
Vmn2r118	T	A	17: 55,608,093	S518C	probably damaging	Het
Vmn2r49	A	G	7: 9,976,597	I736T	probably damaging	Het
Wdr38	T	A	2: 38,999,958		probably null	Het
Wee2	A	G	6: 40,452,619	E180G	probably benign	Het
Zc3h7a	T	C	16: 11,158,765		probably null	Het
Zfp516	T	A	18: 82,955,710	L11Q	probably damaging	Het
Zfp623	G	A	15: 75,947,468	R91H	probably benign	Het
Zkscan7	G	A	9: 122,896,105	R713Q	probably benign	Het

Other mutations in Zbtb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01891:Zbtb1	APN	12	76385661	missense	probably damaging	1.00
IGL02097:Zbtb1	APN	12	76386597	missense	probably damaging	1.00
IGL02328:Zbtb1	APN	12	76386676	missense	possibly damaging	0.75
IGL02496:Zbtb1	APN	12	76385395	missense	possibly damaging	0.76
IGL03270:Zbtb1	APN	12	76385515	missense	possibly damaging	0.59
Limited	UTSW	12	76385827	missense	probably damaging	0.99
Occasional	UTSW	12	76387010	missense	probably damaging	1.00
Old_friend	UTSW	12	76385891	missense	probably damaging	0.96
scant	UTSW	12	76385461	missense	probably damaging	1.00
R0893:Zbtb1	UTSW	12	76385339	missense	probably damaging	1.00
R1317:Zbtb1	UTSW	12	76386799	missense	probably benign	0.00
R1525:Zbtb1	UTSW	12	76386432	missense	probably benign
R1761:Zbtb1	UTSW	12	76385821	nonsense	probably null
R2920:Zbtb1	UTSW	12	76385845	missense	possibly damaging	0.83
R5307:Zbtb1	UTSW	12	76386240	missense	probably damaging	1.00
R5718:Zbtb1	UTSW	12	76386924	missense	probably benign
R5975:Zbtb1	UTSW	12	76386275	missense	possibly damaging	0.88
R6484:Zbtb1	UTSW	12	76385891	missense	probably damaging	0.96
R6493:Zbtb1	UTSW	12	76386473	missense	probably benign
R6904:Zbtb1	UTSW	12	76386211	nonsense	probably null
R6948:Zbtb1	UTSW	12	76385827	missense	probably damaging	0.99
R8725:Zbtb1	UTSW	12	76385872	missense	probably damaging	1.00
R9202:Zbtb1	UTSW	12	76387010	missense	probably damaging	1.00
R9303:Zbtb1	UTSW	12	76385999	missense	probably damaging	0.98
R9305:Zbtb1	UTSW	12	76385999	missense	probably damaging	0.98
X0028:Zbtb1	UTSW	12	76385299	missense	probably damaging	1.00
Z1191:Zbtb1	UTSW	12	76385249	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGACGCAGACTGTTCTAGTTC -3'
(R):5'- ACTATTCGGTGGTAAGCTCTTG -3'

Sequencing Primer
(F):5'- GACGCAGACTGTTCTAGTTCAAAGTG -3'
(R):5'- CGGTGGTAAGCTCTTGTCGTG -3'

Posted On

2018-06-06