Incidental Mutation 'R6513:Tbc1d31'
ID520025
Institutional Source Beutler Lab
Gene Symbol Tbc1d31
Ensembl Gene ENSMUSG00000022364
Gene NameTBC1 domain family, member 31
SynonymsLOC210544, Wdr67, D330013L20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6513 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location57912199-57970067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57955382 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 794 (R794W)
Ref Sequence ENSEMBL: ENSMUSP00000022992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022992]
Predicted Effect probably damaging
Transcript: ENSMUST00000022992
AA Change: R794W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022992
Gene: ENSMUSG00000022364
AA Change: R794W

DomainStartEndE-ValueType
WD40 39 70 3.3e1 SMART
WD40 72 112 7.64e1 SMART
WD40 115 153 1.42e-4 SMART
WD40 156 196 1.03e1 SMART
WD40 199 242 6.6e1 SMART
Blast:WD40 245 292 8e-23 BLAST
WD40 295 334 2.48e0 SMART
Pfam:RabGAP-TBC 427 619 9.5e-11 PFAM
coiled coil region 699 844 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160098
Predicted Effect probably benign
Transcript: ENSMUST00000161329
SMART Domains Protein: ENSMUSP00000124466
Gene: ENSMUSG00000022364

DomainStartEndE-ValueType
coiled coil region 97 124 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162157
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,766 S161G probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ankrd11 A G 8: 122,890,180 V2290A probably benign Het
Aox4 A G 1: 58,213,053 N29S probably benign Het
Arhgap17 T C 7: 123,292,156 R592G possibly damaging Het
BC027072 T A 17: 71,744,706 E1217V probably damaging Het
C87414 C A 5: 93,637,532 probably null Het
Caap1 A T 4: 94,501,403 D231E possibly damaging Het
Cabp1 T A 5: 115,169,134 M165L possibly damaging Het
Cep72 A T 13: 74,058,463 L73H probably damaging Het
Cfap74 A G 4: 155,441,286 S731G probably null Het
Dsc2 T C 18: 20,046,238 I258V probably benign Het
Dsg1c T G 18: 20,274,630 N344K probably benign Het
Enah A G 1: 182,014,355 probably benign Het
Fam26d T A 10: 34,041,634 R274* probably null Het
Fbn1 T A 2: 125,383,671 S554C probably damaging Het
Fkrp C A 7: 16,811,112 R275L possibly damaging Het
Gbp4 C T 5: 105,123,120 G215D possibly damaging Het
Gli2 G A 1: 118,855,554 L239F probably damaging Het
Gpr146 A G 5: 139,392,818 D125G probably damaging Het
Hectd4 C A 5: 121,356,196 probably null Het
Invs G A 4: 48,397,534 V370I possibly damaging Het
Kdm2b A G 5: 122,880,239 V1040A probably damaging Het
Kidins220 T A 12: 25,038,435 V1059D possibly damaging Het
Kif1bp T C 10: 62,575,034 probably null Het
Kif26a T A 12: 112,175,492 S727T probably damaging Het
Klk1b27 A G 7: 44,055,745 H112R probably benign Het
Krt72 T G 15: 101,776,752 probably null Het
Lactb C T 9: 66,970,890 R219H probably damaging Het
Lrig2 A T 3: 104,465,729 I612N probably damaging Het
Meaf6 A C 4: 125,089,904 N51T probably damaging Het
Mtap A G 4: 89,148,261 T36A possibly damaging Het
Myo3a G A 2: 22,407,332 G713S probably damaging Het
Nr4a3 C T 4: 48,083,255 T596I probably damaging Het
Olfr1306 C G 2: 111,912,883 G16R possibly damaging Het
Olfr1338 A T 4: 118,754,027 C172* probably null Het
Pam A G 1: 97,838,027 V759A possibly damaging Het
Pds5a T A 5: 65,615,601 I1220F probably benign Het
Phldb2 T A 16: 45,747,877 M1222L possibly damaging Het
Phospho1 C T 11: 95,830,687 A61V possibly damaging Het
Pnpla7 G A 2: 25,016,538 V638I possibly damaging Het
Ptf1a T A 2: 19,447,037 D282E probably damaging Het
Ptgs2 A T 1: 150,100,128 probably benign Het
Racgap1 T C 15: 99,624,275 R471G probably damaging Het
Rptn T C 3: 93,396,112 S251P possibly damaging Het
Shcbp1 T C 8: 4,744,507 M429V probably benign Het
Shprh T C 10: 11,186,893 L1248P probably damaging Het
Son T C 16: 91,659,947 probably benign Het
Sppl3 T C 5: 115,095,936 L355P probably damaging Het
Telo2 T C 17: 25,101,412 Y766C probably damaging Het
Tfr2 A G 5: 137,574,531 probably null Het
Tle4 T C 19: 14,451,692 D722G probably damaging Het
Tprgl A G 4: 154,159,405 V98A probably benign Het
Trak1 C T 9: 121,443,756 R237C probably benign Het
Vmn2r113 T C 17: 22,958,741 I833T probably damaging Het
Vmn2r118 T A 17: 55,608,093 S518C probably damaging Het
Vmn2r49 A G 7: 9,976,597 I736T probably damaging Het
Wdr38 T A 2: 38,999,958 probably null Het
Wee2 A G 6: 40,452,619 E180G probably benign Het
Zbtb1 T C 12: 76,385,830 S197P possibly damaging Het
Zc3h7a T C 16: 11,158,765 probably null Het
Zfp516 T A 18: 82,955,710 L11Q probably damaging Het
Zfp623 G A 15: 75,947,468 R91H probably benign Het
Zkscan7 G A 9: 122,896,105 R713Q probably benign Het
Other mutations in Tbc1d31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Tbc1d31 APN 15 57940768 missense probably benign 0.03
IGL01955:Tbc1d31 APN 15 57942370 missense probably benign 0.24
IGL02024:Tbc1d31 APN 15 57919942 missense probably benign 0.10
IGL02501:Tbc1d31 APN 15 57937948 missense probably benign 0.11
IGL03133:Tbc1d31 APN 15 57942459 splice site probably benign
IGL03159:Tbc1d31 APN 15 57920048 critical splice donor site probably null
new_age UTSW 15 57951706 missense probably damaging 1.00
PIT4354001:Tbc1d31 UTSW 15 57967933 missense probably benign 0.09
R0239:Tbc1d31 UTSW 15 57940753 missense probably benign 0.14
R0239:Tbc1d31 UTSW 15 57940753 missense probably benign 0.14
R0375:Tbc1d31 UTSW 15 57955350 missense probably benign
R0478:Tbc1d31 UTSW 15 57932536 missense probably damaging 1.00
R0576:Tbc1d31 UTSW 15 57969724 missense possibly damaging 0.79
R1328:Tbc1d31 UTSW 15 57942463 splice site probably benign
R1454:Tbc1d31 UTSW 15 57951638 nonsense probably null
R1784:Tbc1d31 UTSW 15 57963920 missense possibly damaging 0.86
R1874:Tbc1d31 UTSW 15 57916110 missense probably benign 0.41
R1920:Tbc1d31 UTSW 15 57912364 missense probably damaging 1.00
R2111:Tbc1d31 UTSW 15 57932644 missense probably benign 0.05
R2174:Tbc1d31 UTSW 15 57951741 missense possibly damaging 0.95
R2205:Tbc1d31 UTSW 15 57953520 missense probably benign 0.11
R3683:Tbc1d31 UTSW 15 57951814 critical splice donor site probably null
R3825:Tbc1d31 UTSW 15 57916078 missense probably benign 0.43
R4407:Tbc1d31 UTSW 15 57920042 missense possibly damaging 0.93
R4627:Tbc1d31 UTSW 15 57967912 missense probably benign
R4792:Tbc1d31 UTSW 15 57940728 missense probably benign 0.03
R4804:Tbc1d31 UTSW 15 57951106 nonsense probably null
R4909:Tbc1d31 UTSW 15 57962265 critical splice donor site probably null
R5077:Tbc1d31 UTSW 15 57955401 missense probably benign 0.00
R5230:Tbc1d31 UTSW 15 57960919 missense probably damaging 0.99
R5436:Tbc1d31 UTSW 15 57952871 missense probably benign 0.04
R5652:Tbc1d31 UTSW 15 57951666 missense probably damaging 1.00
R5920:Tbc1d31 UTSW 15 57942558 missense probably benign 0.10
R6102:Tbc1d31 UTSW 15 57936093 missense probably damaging 1.00
R6176:Tbc1d31 UTSW 15 57952796 missense probably damaging 0.99
R6778:Tbc1d31 UTSW 15 57938029 missense probably damaging 1.00
R6795:Tbc1d31 UTSW 15 57951706 missense probably damaging 1.00
R7187:Tbc1d31 UTSW 15 57938063 missense possibly damaging 0.95
R7308:Tbc1d31 UTSW 15 57952816 missense probably damaging 1.00
R7359:Tbc1d31 UTSW 15 57916108 missense probably benign 0.00
R7453:Tbc1d31 UTSW 15 57950995 missense probably damaging 1.00
R7552:Tbc1d31 UTSW 15 57940740 missense probably benign
R7606:Tbc1d31 UTSW 15 57951670 missense probably damaging 1.00
R7739:Tbc1d31 UTSW 15 57936098 nonsense probably null
R7782:Tbc1d31 UTSW 15 57958368 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTATCCAAACAGCACAGGC -3'
(R):5'- AGAAGACTATTTCCCTGACACAG -3'

Sequencing Primer
(F):5'- GTTTTTCAGGCTAGCTGC -3'
(R):5'- CCCTGACACAGTTTTATTTCTAGAG -3'
Posted On2018-06-06