Incidental Mutation 'R6513:Krt72'
ID520028
Institutional Source Beutler Lab
Gene Symbol Krt72
Ensembl Gene ENSMUSG00000056605
Gene Namekeratin 72
SynonymsKrt72-ps, K6irs2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6513 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101776172-101786460 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to G at 101776752 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000065922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071104] [ENSMUST00000071104]
Predicted Effect probably null
Transcript: ENSMUST00000071104
SMART Domains Protein: ENSMUSP00000065922
Gene: ENSMUSG00000056605

DomainStartEndE-ValueType
Pfam:Keratin_2_head 59 130 3.1e-17 PFAM
Filament 133 446 6.9e-157 SMART
low complexity region 454 462 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
low complexity region 507 519 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000071104
SMART Domains Protein: ENSMUSP00000065922
Gene: ENSMUSG00000056605

DomainStartEndE-ValueType
Pfam:Keratin_2_head 59 130 3.1e-17 PFAM
Filament 133 446 6.9e-157 SMART
low complexity region 454 462 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
low complexity region 507 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127671
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells. The type II keratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This gene encodes a type II keratin that is specifically expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q12-q13. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,766 S161G probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ankrd11 A G 8: 122,890,180 V2290A probably benign Het
Aox4 A G 1: 58,213,053 N29S probably benign Het
Arhgap17 T C 7: 123,292,156 R592G possibly damaging Het
BC027072 T A 17: 71,744,706 E1217V probably damaging Het
C87414 C A 5: 93,637,532 probably null Het
Caap1 A T 4: 94,501,403 D231E possibly damaging Het
Cabp1 T A 5: 115,169,134 M165L possibly damaging Het
Cep72 A T 13: 74,058,463 L73H probably damaging Het
Cfap74 A G 4: 155,441,286 S731G probably null Het
Dsc2 T C 18: 20,046,238 I258V probably benign Het
Dsg1c T G 18: 20,274,630 N344K probably benign Het
Enah A G 1: 182,014,355 probably benign Het
Fam26d T A 10: 34,041,634 R274* probably null Het
Fbn1 T A 2: 125,383,671 S554C probably damaging Het
Fkrp C A 7: 16,811,112 R275L possibly damaging Het
Gbp4 C T 5: 105,123,120 G215D possibly damaging Het
Gli2 G A 1: 118,855,554 L239F probably damaging Het
Gpr146 A G 5: 139,392,818 D125G probably damaging Het
Hectd4 C A 5: 121,356,196 probably null Het
Invs G A 4: 48,397,534 V370I possibly damaging Het
Kdm2b A G 5: 122,880,239 V1040A probably damaging Het
Kidins220 T A 12: 25,038,435 V1059D possibly damaging Het
Kif1bp T C 10: 62,575,034 probably null Het
Kif26a T A 12: 112,175,492 S727T probably damaging Het
Klk1b27 A G 7: 44,055,745 H112R probably benign Het
Lactb C T 9: 66,970,890 R219H probably damaging Het
Lrig2 A T 3: 104,465,729 I612N probably damaging Het
Meaf6 A C 4: 125,089,904 N51T probably damaging Het
Mtap A G 4: 89,148,261 T36A possibly damaging Het
Myo3a G A 2: 22,407,332 G713S probably damaging Het
Nr4a3 C T 4: 48,083,255 T596I probably damaging Het
Olfr1306 C G 2: 111,912,883 G16R possibly damaging Het
Olfr1338 A T 4: 118,754,027 C172* probably null Het
Pam A G 1: 97,838,027 V759A possibly damaging Het
Pds5a T A 5: 65,615,601 I1220F probably benign Het
Phldb2 T A 16: 45,747,877 M1222L possibly damaging Het
Phospho1 C T 11: 95,830,687 A61V possibly damaging Het
Pnpla7 G A 2: 25,016,538 V638I possibly damaging Het
Ptf1a T A 2: 19,447,037 D282E probably damaging Het
Ptgs2 A T 1: 150,100,128 probably benign Het
Racgap1 T C 15: 99,624,275 R471G probably damaging Het
Rptn T C 3: 93,396,112 S251P possibly damaging Het
Shcbp1 T C 8: 4,744,507 M429V probably benign Het
Shprh T C 10: 11,186,893 L1248P probably damaging Het
Son T C 16: 91,659,947 probably benign Het
Sppl3 T C 5: 115,095,936 L355P probably damaging Het
Tbc1d31 A T 15: 57,955,382 R794W probably damaging Het
Telo2 T C 17: 25,101,412 Y766C probably damaging Het
Tfr2 A G 5: 137,574,531 probably null Het
Tle4 T C 19: 14,451,692 D722G probably damaging Het
Tprgl A G 4: 154,159,405 V98A probably benign Het
Trak1 C T 9: 121,443,756 R237C probably benign Het
Vmn2r113 T C 17: 22,958,741 I833T probably damaging Het
Vmn2r118 T A 17: 55,608,093 S518C probably damaging Het
Vmn2r49 A G 7: 9,976,597 I736T probably damaging Het
Wdr38 T A 2: 38,999,958 probably null Het
Wee2 A G 6: 40,452,619 E180G probably benign Het
Zbtb1 T C 12: 76,385,830 S197P possibly damaging Het
Zc3h7a T C 16: 11,158,765 probably null Het
Zfp516 T A 18: 82,955,710 L11Q probably damaging Het
Zfp623 G A 15: 75,947,468 R91H probably benign Het
Zkscan7 G A 9: 122,896,105 R713Q probably benign Het
Other mutations in Krt72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Krt72 APN 15 101784999 missense probably damaging 0.99
IGL00568:Krt72 APN 15 101781015 missense probably damaging 1.00
IGL00966:Krt72 APN 15 101780961 missense probably damaging 1.00
IGL01997:Krt72 APN 15 101784880 missense probably damaging 0.99
IGL02858:Krt72 APN 15 101782121 missense probably damaging 1.00
IGL03260:Krt72 APN 15 101778273 missense probably damaging 1.00
R0062:Krt72 UTSW 15 101786008 missense probably damaging 0.98
R0062:Krt72 UTSW 15 101786008 missense probably damaging 0.98
R0601:Krt72 UTSW 15 101786056 missense probably damaging 1.00
R0669:Krt72 UTSW 15 101778305 missense probably damaging 0.99
R1396:Krt72 UTSW 15 101786005 critical splice donor site probably null
R1501:Krt72 UTSW 15 101778334 missense probably damaging 1.00
R1598:Krt72 UTSW 15 101780253 missense probably benign 0.00
R1779:Krt72 UTSW 15 101780929 missense probably benign
R1796:Krt72 UTSW 15 101781552 splice site probably null
R4259:Krt72 UTSW 15 101778257 missense probably damaging 0.99
R4835:Krt72 UTSW 15 101781073 splice site probably null
R4871:Krt72 UTSW 15 101786034 missense probably damaging 1.00
R6246:Krt72 UTSW 15 101780937 missense probably damaging 1.00
R6520:Krt72 UTSW 15 101781046 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTCTGTCATCTGGAGGTC -3'
(R):5'- CAGCCATGGTTATGAATGGTGTC -3'

Sequencing Primer
(F):5'- CATCTGGAGGTCTTTTTGGTTGTACC -3'
(R):5'- TGGTGTCCACAAAGATATCTCAG -3'
Posted On2018-06-06