Incidental Mutation 'R6513:Phldb2'
ID520030
Institutional Source Beutler Lab
Gene Symbol Phldb2
Ensembl Gene ENSMUSG00000033149
Gene Namepleckstrin homology like domain, family B, member 2
SynonymsLL5b, LL5beta, C820004H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6513 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location45746243-45953598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45747877 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1222 (M1222L)
Ref Sequence ENSEMBL: ENSMUSP00000046496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036355] [ENSMUST00000066983] [ENSMUST00000076333] [ENSMUST00000128348]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036355
AA Change: M1222L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046496
Gene: ENSMUSG00000033149
AA Change: M1222L

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
coiled coil region 1027 1097 N/A INTRINSIC
PH 1140 1244 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066983
SMART Domains Protein: ENSMUSP00000065282
Gene: ENSMUSG00000033157

DomainStartEndE-ValueType
Pfam:Hydrolase_4 65 209 6.9e-9 PFAM
Pfam:Abhydrolase_1 67 226 7.3e-9 PFAM
Pfam:Abhydrolase_5 68 271 2.4e-15 PFAM
Pfam:Abhydrolase_6 69 280 4.4e-9 PFAM
Pfam:Peptidase_S9 131 281 8.9e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000076333
AA Change: M1275L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075672
Gene: ENSMUSG00000033149
AA Change: M1275L

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
coiled coil region 1080 1150 N/A INTRINSIC
PH 1193 1297 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128348
Predicted Effect unknown
Transcript: ENSMUST00000131003
AA Change: M537L
SMART Domains Protein: ENSMUSP00000119718
Gene: ENSMUSG00000033149
AA Change: M537L

DomainStartEndE-ValueType
coiled coil region 1 55 N/A INTRINSIC
coiled coil region 87 163 N/A INTRINSIC
coiled coil region 342 412 N/A INTRINSIC
PH 456 560 6.45e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155741
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,766 S161G probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ankrd11 A G 8: 122,890,180 V2290A probably benign Het
Aox4 A G 1: 58,213,053 N29S probably benign Het
Arhgap17 T C 7: 123,292,156 R592G possibly damaging Het
BC027072 T A 17: 71,744,706 E1217V probably damaging Het
C87414 C A 5: 93,637,532 probably null Het
Caap1 A T 4: 94,501,403 D231E possibly damaging Het
Cabp1 T A 5: 115,169,134 M165L possibly damaging Het
Cep72 A T 13: 74,058,463 L73H probably damaging Het
Cfap74 A G 4: 155,441,286 S731G probably null Het
Dsc2 T C 18: 20,046,238 I258V probably benign Het
Dsg1c T G 18: 20,274,630 N344K probably benign Het
Enah A G 1: 182,014,355 probably benign Het
Fam26d T A 10: 34,041,634 R274* probably null Het
Fbn1 T A 2: 125,383,671 S554C probably damaging Het
Fkrp C A 7: 16,811,112 R275L possibly damaging Het
Gbp4 C T 5: 105,123,120 G215D possibly damaging Het
Gli2 G A 1: 118,855,554 L239F probably damaging Het
Gpr146 A G 5: 139,392,818 D125G probably damaging Het
Hectd4 C A 5: 121,356,196 probably null Het
Invs G A 4: 48,397,534 V370I possibly damaging Het
Kdm2b A G 5: 122,880,239 V1040A probably damaging Het
Kidins220 T A 12: 25,038,435 V1059D possibly damaging Het
Kif1bp T C 10: 62,575,034 probably null Het
Kif26a T A 12: 112,175,492 S727T probably damaging Het
Klk1b27 A G 7: 44,055,745 H112R probably benign Het
Krt72 T G 15: 101,776,752 probably null Het
Lactb C T 9: 66,970,890 R219H probably damaging Het
Lrig2 A T 3: 104,465,729 I612N probably damaging Het
Meaf6 A C 4: 125,089,904 N51T probably damaging Het
Mtap A G 4: 89,148,261 T36A possibly damaging Het
Myo3a G A 2: 22,407,332 G713S probably damaging Het
Nr4a3 C T 4: 48,083,255 T596I probably damaging Het
Olfr1306 C G 2: 111,912,883 G16R possibly damaging Het
Olfr1338 A T 4: 118,754,027 C172* probably null Het
Pam A G 1: 97,838,027 V759A possibly damaging Het
Pds5a T A 5: 65,615,601 I1220F probably benign Het
Phospho1 C T 11: 95,830,687 A61V possibly damaging Het
Pnpla7 G A 2: 25,016,538 V638I possibly damaging Het
Ptf1a T A 2: 19,447,037 D282E probably damaging Het
Ptgs2 A T 1: 150,100,128 probably benign Het
Racgap1 T C 15: 99,624,275 R471G probably damaging Het
Rptn T C 3: 93,396,112 S251P possibly damaging Het
Shcbp1 T C 8: 4,744,507 M429V probably benign Het
Shprh T C 10: 11,186,893 L1248P probably damaging Het
Son T C 16: 91,659,947 probably benign Het
Sppl3 T C 5: 115,095,936 L355P probably damaging Het
Tbc1d31 A T 15: 57,955,382 R794W probably damaging Het
Telo2 T C 17: 25,101,412 Y766C probably damaging Het
Tfr2 A G 5: 137,574,531 probably null Het
Tle4 T C 19: 14,451,692 D722G probably damaging Het
Tprgl A G 4: 154,159,405 V98A probably benign Het
Trak1 C T 9: 121,443,756 R237C probably benign Het
Vmn2r113 T C 17: 22,958,741 I833T probably damaging Het
Vmn2r118 T A 17: 55,608,093 S518C probably damaging Het
Vmn2r49 A G 7: 9,976,597 I736T probably damaging Het
Wdr38 T A 2: 38,999,958 probably null Het
Wee2 A G 6: 40,452,619 E180G probably benign Het
Zbtb1 T C 12: 76,385,830 S197P possibly damaging Het
Zc3h7a T C 16: 11,158,765 probably null Het
Zfp516 T A 18: 82,955,710 L11Q probably damaging Het
Zfp623 G A 15: 75,947,468 R91H probably benign Het
Zkscan7 G A 9: 122,896,105 R713Q probably benign Het
Other mutations in Phldb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Phldb2 APN 16 45772254 missense probably damaging 1.00
IGL00485:Phldb2 APN 16 45757188 missense possibly damaging 0.75
IGL00544:Phldb2 APN 16 45825311 missense probably damaging 1.00
IGL00547:Phldb2 APN 16 45825535 missense probably benign 0.00
IGL00835:Phldb2 APN 16 45751456 missense probably damaging 1.00
IGL00987:Phldb2 APN 16 45763102 missense possibly damaging 0.78
IGL01102:Phldb2 APN 16 45825060 missense probably damaging 1.00
IGL01530:Phldb2 APN 16 45802729 missense probably damaging 1.00
IGL01549:Phldb2 APN 16 45774318 missense probably benign 0.00
IGL01712:Phldb2 APN 16 45751429 missense probably damaging 1.00
IGL01755:Phldb2 APN 16 45825582 missense probably damaging 0.96
IGL01823:Phldb2 APN 16 45825144 missense probably damaging 0.97
IGL02353:Phldb2 APN 16 45748779 missense probably damaging 1.00
IGL02360:Phldb2 APN 16 45748779 missense probably damaging 1.00
IGL02716:Phldb2 APN 16 45801590 missense probably damaging 0.99
R0139:Phldb2 UTSW 16 45770666 splice site probably benign
R0312:Phldb2 UTSW 16 45789047 missense probably damaging 1.00
R0379:Phldb2 UTSW 16 45781451 missense probably damaging 1.00
R0535:Phldb2 UTSW 16 45757127 missense probably damaging 1.00
R1387:Phldb2 UTSW 16 45825994 missense possibly damaging 0.69
R1444:Phldb2 UTSW 16 45757253 splice site probably benign
R1487:Phldb2 UTSW 16 45789024 missense probably damaging 1.00
R1501:Phldb2 UTSW 16 45777783 missense probably damaging 1.00
R1605:Phldb2 UTSW 16 45770779 splice site probably benign
R1716:Phldb2 UTSW 16 45775050 missense probably benign 0.01
R1732:Phldb2 UTSW 16 45757166 missense probably damaging 1.00
R1779:Phldb2 UTSW 16 45801625 missense probably damaging 1.00
R1824:Phldb2 UTSW 16 45826011 missense probably benign 0.14
R2001:Phldb2 UTSW 16 45774195 missense possibly damaging 0.66
R2066:Phldb2 UTSW 16 45770758 missense probably damaging 1.00
R2122:Phldb2 UTSW 16 45762941 missense probably damaging 0.99
R2448:Phldb2 UTSW 16 45825363 missense probably damaging 1.00
R2932:Phldb2 UTSW 16 45748785 missense possibly damaging 0.85
R3076:Phldb2 UTSW 16 45825010 missense probably benign 0.00
R3078:Phldb2 UTSW 16 45825010 missense probably benign 0.00
R3779:Phldb2 UTSW 16 45748755 missense probably damaging 1.00
R3914:Phldb2 UTSW 16 45757163 missense probably damaging 1.00
R4536:Phldb2 UTSW 16 45770681 missense probably benign 0.04
R4568:Phldb2 UTSW 16 45777718 nonsense probably null
R4798:Phldb2 UTSW 16 45825874 missense probably damaging 1.00
R4853:Phldb2 UTSW 16 45802716 missense probably damaging 0.99
R4906:Phldb2 UTSW 16 45751395 missense probably damaging 1.00
R4984:Phldb2 UTSW 16 45825633 missense probably damaging 1.00
R5078:Phldb2 UTSW 16 45777742 missense possibly damaging 0.85
R5137:Phldb2 UTSW 16 45808258 missense possibly damaging 0.85
R5237:Phldb2 UTSW 16 45747886 missense probably damaging 0.99
R5410:Phldb2 UTSW 16 45825612 missense possibly damaging 0.77
R5825:Phldb2 UTSW 16 45763097 missense probably benign 0.11
R5874:Phldb2 UTSW 16 45801625 missense probably damaging 1.00
R5907:Phldb2 UTSW 16 45825188 missense probably damaging 1.00
R6332:Phldb2 UTSW 16 45774246 missense probably benign
R6354:Phldb2 UTSW 16 45825114 missense probably damaging 1.00
R6355:Phldb2 UTSW 16 45825338 missense probably damaging 0.99
R6383:Phldb2 UTSW 16 45748750 missense probably damaging 1.00
R6463:Phldb2 UTSW 16 45774993 missense probably benign 0.37
R6593:Phldb2 UTSW 16 45825427 nonsense probably null
R6756:Phldb2 UTSW 16 45808320 missense probably benign 0.02
R6810:Phldb2 UTSW 16 45748725 critical splice donor site probably null
R6897:Phldb2 UTSW 16 45777775 missense probably damaging 1.00
R7010:Phldb2 UTSW 16 45751505 missense probably damaging 0.99
R7142:Phldb2 UTSW 16 45757176 nonsense probably null
R7149:Phldb2 UTSW 16 45751532 nonsense probably null
R7249:Phldb2 UTSW 16 45801614 missense probably damaging 1.00
R7300:Phldb2 UTSW 16 45825562 missense probably damaging 1.00
R7328:Phldb2 UTSW 16 45758209 critical splice acceptor site probably null
R7515:Phldb2 UTSW 16 45774240 missense possibly damaging 0.90
R7840:Phldb2 UTSW 16 45751364 missense probably damaging 1.00
R7988:Phldb2 UTSW 16 45825571 missense probably benign 0.03
R8159:Phldb2 UTSW 16 45860384 missense possibly damaging 0.82
R8353:Phldb2 UTSW 16 45825022 missense probably benign 0.00
R8453:Phldb2 UTSW 16 45825022 missense probably benign 0.00
RF008:Phldb2 UTSW 16 45762974 missense probably damaging 1.00
Z1176:Phldb2 UTSW 16 45825826 missense probably benign 0.43
Z1176:Phldb2 UTSW 16 45825827 missense probably benign 0.04
Z1176:Phldb2 UTSW 16 45953508 unclassified probably benign
Z1190:Phldb2 UTSW 16 45825334 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCCTTTCCATCTGAGACTGG -3'
(R):5'- CAAAAGATGGCCCATCCTGG -3'

Sequencing Primer
(F):5'- CATCTGAGACTGGATATGGCTTCAC -3'
(R):5'- CCATCCTGGGGAGAGTGTACAG -3'
Posted On2018-06-06