Mutagenetix > Incidental Mutations

Incidental Mutation 'R6513:Vmn2r118'

520035

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r118

Ensembl Gene

ENSMUSG00000091504

Gene Name

vomeronasal 2, receptor 118

Synonyms

EG383258, Vmn2r119, EG668547

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.133) question?

Stock #

R6513 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55592341-55624672 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 55608093 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 518 (S518C)

Ref Sequence

ENSEMBL: ENSMUSP00000131128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168440]

Predicted Effect

probably damaging
Transcript: ENSMUST00000168440
AA Change: S518C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: S518C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	142	470	4.6e-27	PFAM
Pfam:NCD3G	513	566	2.6e-20	PFAM
Pfam:7tm_3	599	834	5.9e-55	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

98% (62/63)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438H23Rik	T	C	16: 91,055,766	S161G	probably benign	Het
Ankfy1	G	A	11: 72,730,482	R198Q	possibly damaging	Het
Ankrd11	A	G	8: 122,890,180	V2290A	probably benign	Het
Aox4	A	G	1: 58,213,053	N29S	probably benign	Het
Arhgap17	T	C	7: 123,292,156	R592G	possibly damaging	Het
BC027072	T	A	17: 71,744,706	E1217V	probably damaging	Het
C87414	C	A	5: 93,637,532		probably null	Het
Caap1	A	T	4: 94,501,403	D231E	possibly damaging	Het
Cabp1	T	A	5: 115,169,134	M165L	possibly damaging	Het
Cep72	A	T	13: 74,058,463	L73H	probably damaging	Het
Cfap74	A	G	4: 155,441,286	S731G	probably null	Het
Dsc2	T	C	18: 20,046,238	I258V	probably benign	Het
Dsg1c	T	G	18: 20,274,630	N344K	probably benign	Het
Enah	A	G	1: 182,014,355		probably benign	Het
Fam26d	T	A	10: 34,041,634	R274*	probably null	Het
Fbn1	T	A	2: 125,383,671	S554C	probably damaging	Het
Fkrp	C	A	7: 16,811,112	R275L	possibly damaging	Het
Gbp4	C	T	5: 105,123,120	G215D	possibly damaging	Het
Gli2	G	A	1: 118,855,554	L239F	probably damaging	Het
Gpr146	A	G	5: 139,392,818	D125G	probably damaging	Het
Hectd4	C	A	5: 121,356,196		probably null	Het
Invs	G	A	4: 48,397,534	V370I	possibly damaging	Het
Kdm2b	A	G	5: 122,880,239	V1040A	probably damaging	Het
Kidins220	T	A	12: 25,038,435	V1059D	possibly damaging	Het
Kif1bp	T	C	10: 62,575,034		probably null	Het
Kif26a	T	A	12: 112,175,492	S727T	probably damaging	Het
Klk1b27	A	G	7: 44,055,745	H112R	probably benign	Het
Krt72	T	G	15: 101,776,752		probably null	Het
Lactb	C	T	9: 66,970,890	R219H	probably damaging	Het
Lrig2	A	T	3: 104,465,729	I612N	probably damaging	Het
Meaf6	A	C	4: 125,089,904	N51T	probably damaging	Het
Mtap	A	G	4: 89,148,261	T36A	possibly damaging	Het
Myo3a	G	A	2: 22,407,332	G713S	probably damaging	Het
Nr4a3	C	T	4: 48,083,255	T596I	probably damaging	Het
Olfr1306	C	G	2: 111,912,883	G16R	possibly damaging	Het
Olfr1338	A	T	4: 118,754,027	C172*	probably null	Het
Pam	A	G	1: 97,838,027	V759A	possibly damaging	Het
Pds5a	T	A	5: 65,615,601	I1220F	probably benign	Het
Phldb2	T	A	16: 45,747,877	M1222L	possibly damaging	Het
Phospho1	C	T	11: 95,830,687	A61V	possibly damaging	Het
Pnpla7	G	A	2: 25,016,538	V638I	possibly damaging	Het
Ptf1a	T	A	2: 19,447,037	D282E	probably damaging	Het
Ptgs2	A	T	1: 150,100,128		probably benign	Het
Racgap1	T	C	15: 99,624,275	R471G	probably damaging	Het
Rptn	T	C	3: 93,396,112	S251P	possibly damaging	Het
Shcbp1	T	C	8: 4,744,507	M429V	probably benign	Het
Shprh	T	C	10: 11,186,893	L1248P	probably damaging	Het
Son	T	C	16: 91,659,947		probably benign	Het
Sppl3	T	C	5: 115,095,936	L355P	probably damaging	Het
Tbc1d31	A	T	15: 57,955,382	R794W	probably damaging	Het
Telo2	T	C	17: 25,101,412	Y766C	probably damaging	Het
Tfr2	A	G	5: 137,574,531		probably null	Het
Tle4	T	C	19: 14,451,692	D722G	probably damaging	Het
Tprgl	A	G	4: 154,159,405	V98A	probably benign	Het
Trak1	C	T	9: 121,443,756	R237C	probably benign	Het
Vmn2r113	T	C	17: 22,958,741	I833T	probably damaging	Het
Vmn2r49	A	G	7: 9,976,597	I736T	probably damaging	Het
Wdr38	T	A	2: 38,999,958		probably null	Het
Wee2	A	G	6: 40,452,619	E180G	probably benign	Het
Zbtb1	T	C	12: 76,385,830	S197P	possibly damaging	Het
Zc3h7a	T	C	16: 11,158,765		probably null	Het
Zfp516	T	A	18: 82,955,710	L11Q	probably damaging	Het
Zfp623	G	A	15: 75,947,468	R91H	probably benign	Het
Zkscan7	G	A	9: 122,896,105	R713Q	probably benign	Het

Other mutations in Vmn2r118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Vmn2r118	APN	17	55592708	missense	probably damaging	1.00
IGL00976:Vmn2r118	APN	17	55593204	missense	probably damaging	1.00
IGL01419:Vmn2r118	APN	17	55593000	missense	probably benign	0.01
IGL01796:Vmn2r118	APN	17	55608585	missense	probably benign	0.30
IGL01799:Vmn2r118	APN	17	55592990	missense	probably damaging	1.00
IGL02002:Vmn2r118	APN	17	55592619	missense	probably damaging	1.00
IGL02075:Vmn2r118	APN	17	55610517	missense	probably benign	0.18
IGL02172:Vmn2r118	APN	17	55624598	missense	probably benign	0.00
IGL02529:Vmn2r118	APN	17	55610870	missense	possibly damaging	0.58
IGL02712:Vmn2r118	APN	17	55592655	missense	probably benign	0.21
IGL03096:Vmn2r118	APN	17	55607996	missense	probably damaging	1.00
R0306:Vmn2r118	UTSW	17	55608616	missense	possibly damaging	0.89
R0329:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0330:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0396:Vmn2r118	UTSW	17	55608643	missense	probably benign	0.00
R0411:Vmn2r118	UTSW	17	55611021	splice site	probably benign
R0513:Vmn2r118	UTSW	17	55610970	nonsense	probably null
R0627:Vmn2r118	UTSW	17	55610772	missense	probably benign	0.01
R0638:Vmn2r118	UTSW	17	55608466	missense	probably benign	0.03
R1328:Vmn2r118	UTSW	17	55608620	missense	probably benign	0.01
R1366:Vmn2r118	UTSW	17	55593237	nonsense	probably null
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1511:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R1515:Vmn2r118	UTSW	17	55610643	missense	probably benign	0.25
R1550:Vmn2r118	UTSW	17	55608083	missense	probably damaging	1.00
R1779:Vmn2r118	UTSW	17	55611530	missense	probably benign	0.03
R1834:Vmn2r118	UTSW	17	55592456	missense	probably damaging	1.00
R1840:Vmn2r118	UTSW	17	55610406	nonsense	probably null
R1854:Vmn2r118	UTSW	17	55611556	missense	possibly damaging	0.57
R1967:Vmn2r118	UTSW	17	55592882	missense	probably damaging	1.00
R1976:Vmn2r118	UTSW	17	55592925	missense	probably damaging	1.00
R2308:Vmn2r118	UTSW	17	55624650	missense	probably benign	0.33
R3700:Vmn2r118	UTSW	17	55608421	missense	possibly damaging	0.68
R4334:Vmn2r118	UTSW	17	55610347	missense	possibly damaging	0.58
R4647:Vmn2r118	UTSW	17	55610665	missense	probably damaging	1.00
R4709:Vmn2r118	UTSW	17	55610860	missense	probably damaging	1.00
R4805:Vmn2r118	UTSW	17	55592581	missense	probably damaging	1.00
R4858:Vmn2r118	UTSW	17	55592894	missense	probably damaging	0.98
R5384:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5385:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5664:Vmn2r118	UTSW	17	55592765	missense	possibly damaging	0.46
R5740:Vmn2r118	UTSW	17	55593103	missense	probably benign	0.00
R5927:Vmn2r118	UTSW	17	55624494	missense	probably benign	0.04
R6143:Vmn2r118	UTSW	17	55592871	missense	possibly damaging	0.92
R6573:Vmn2r118	UTSW	17	55592996	missense	probably damaging	1.00
R6760:Vmn2r118	UTSW	17	55592714	missense	possibly damaging	0.92
R6794:Vmn2r118	UTSW	17	55592348	missense	possibly damaging	0.48
R6929:Vmn2r118	UTSW	17	55610440	missense	probably benign	0.01
R7201:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R7539:Vmn2r118	UTSW	17	55592853	missense	probably damaging	0.98
X0022:Vmn2r118	UTSW	17	55593218	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTACCTTCCAGTTACTTTCAAGG -3'
(R):5'- CCAGGTGAGTTTGGCCCAAC -3'

Sequencing Primer
(F):5'- TCAAGGTCTTGATGTGGAGGAAG -3'
(R):5'- CAGGTGAGTTTGGCCCAACTTAATG -3'

Posted On

2018-06-06