Incidental Mutation 'R6513:Dsc2'
ID520037
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Namedesmocollin 2
SynonymsDsc2b, Dsc2a
MMRRC Submission
Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6513 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20030633-20059554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20046238 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 258 (I258V)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
Predicted Effect probably benign
Transcript: ENSMUST00000039247
AA Change: I258V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: I258V

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075214
AA Change: I258V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: I258V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,766 S161G probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ankrd11 A G 8: 122,890,180 V2290A probably benign Het
Aox4 A G 1: 58,213,053 N29S probably benign Het
Arhgap17 T C 7: 123,292,156 R592G possibly damaging Het
BC027072 T A 17: 71,744,706 E1217V probably damaging Het
C87414 C A 5: 93,637,532 probably null Het
Caap1 A T 4: 94,501,403 D231E possibly damaging Het
Cabp1 T A 5: 115,169,134 M165L possibly damaging Het
Cep72 A T 13: 74,058,463 L73H probably damaging Het
Cfap74 A G 4: 155,441,286 S731G probably null Het
Dsg1c T G 18: 20,274,630 N344K probably benign Het
Enah A G 1: 182,014,355 probably benign Het
Fam26d T A 10: 34,041,634 R274* probably null Het
Fbn1 T A 2: 125,383,671 S554C probably damaging Het
Fkrp C A 7: 16,811,112 R275L possibly damaging Het
Gbp4 C T 5: 105,123,120 G215D possibly damaging Het
Gli2 G A 1: 118,855,554 L239F probably damaging Het
Gpr146 A G 5: 139,392,818 D125G probably damaging Het
Hectd4 C A 5: 121,356,196 probably null Het
Invs G A 4: 48,397,534 V370I possibly damaging Het
Kdm2b A G 5: 122,880,239 V1040A probably damaging Het
Kidins220 T A 12: 25,038,435 V1059D possibly damaging Het
Kif1bp T C 10: 62,575,034 probably null Het
Kif26a T A 12: 112,175,492 S727T probably damaging Het
Klk1b27 A G 7: 44,055,745 H112R probably benign Het
Krt72 T G 15: 101,776,752 probably null Het
Lactb C T 9: 66,970,890 R219H probably damaging Het
Lrig2 A T 3: 104,465,729 I612N probably damaging Het
Meaf6 A C 4: 125,089,904 N51T probably damaging Het
Mtap A G 4: 89,148,261 T36A possibly damaging Het
Myo3a G A 2: 22,407,332 G713S probably damaging Het
Nr4a3 C T 4: 48,083,255 T596I probably damaging Het
Olfr1306 C G 2: 111,912,883 G16R possibly damaging Het
Olfr1338 A T 4: 118,754,027 C172* probably null Het
Pam A G 1: 97,838,027 V759A possibly damaging Het
Pds5a T A 5: 65,615,601 I1220F probably benign Het
Phldb2 T A 16: 45,747,877 M1222L possibly damaging Het
Phospho1 C T 11: 95,830,687 A61V possibly damaging Het
Pnpla7 G A 2: 25,016,538 V638I possibly damaging Het
Ptf1a T A 2: 19,447,037 D282E probably damaging Het
Ptgs2 A T 1: 150,100,128 probably benign Het
Racgap1 T C 15: 99,624,275 R471G probably damaging Het
Rptn T C 3: 93,396,112 S251P possibly damaging Het
Shcbp1 T C 8: 4,744,507 M429V probably benign Het
Shprh T C 10: 11,186,893 L1248P probably damaging Het
Son T C 16: 91,659,947 probably benign Het
Sppl3 T C 5: 115,095,936 L355P probably damaging Het
Tbc1d31 A T 15: 57,955,382 R794W probably damaging Het
Telo2 T C 17: 25,101,412 Y766C probably damaging Het
Tfr2 A G 5: 137,574,531 probably null Het
Tle4 T C 19: 14,451,692 D722G probably damaging Het
Tprgl A G 4: 154,159,405 V98A probably benign Het
Trak1 C T 9: 121,443,756 R237C probably benign Het
Vmn2r113 T C 17: 22,958,741 I833T probably damaging Het
Vmn2r118 T A 17: 55,608,093 S518C probably damaging Het
Vmn2r49 A G 7: 9,976,597 I736T probably damaging Het
Wdr38 T A 2: 38,999,958 probably null Het
Wee2 A G 6: 40,452,619 E180G probably benign Het
Zbtb1 T C 12: 76,385,830 S197P possibly damaging Het
Zc3h7a T C 16: 11,158,765 probably null Het
Zfp516 T A 18: 82,955,710 L11Q probably damaging Het
Zfp623 G A 15: 75,947,468 R91H probably benign Het
Zkscan7 G A 9: 122,896,105 R713Q probably benign Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7935:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGATAACCCATTGGCTGG -3'
(R):5'- GAGAAACTGAATTCCATTCCCAGC -3'

Sequencing Primer
(F):5'- TTGGCTGGATAAGAAACTAAGAAACC -3'
(R):5'- TGAATTCCATTCCCAGCACCAC -3'
Posted On2018-06-06