Incidental Mutation 'R6347:Mroh3'
ID520044
Institutional Source Beutler Lab
Gene Symbol Mroh3
Ensembl Gene ENSMUSG00000087230
Gene Namemaestro heat-like repeat family member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6347 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location136181652-136212828 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 136200937 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168561] [ENSMUST00000212798]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166708
Predicted Effect probably benign
Transcript: ENSMUST00000168561
SMART Domains Protein: ENSMUSP00000130772
Gene: ENSMUSG00000087230

DomainStartEndE-ValueType
SCOP:d1gw5a_ 126 669 2e-7 SMART
low complexity region 677 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168561
Predicted Effect probably null
Transcript: ENSMUST00000212798
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G T 2: 173,527,915 R74L possibly damaging Het
Atat1 A G 17: 35,910,029 F3L probably damaging Het
Atf7 T A 15: 102,546,479 M285L possibly damaging Het
Bcl7b T C 5: 135,180,533 S95P possibly damaging Het
Cald1 A C 6: 34,765,046 K453Q probably damaging Het
Cog4 A T 8: 110,880,643 I580F probably damaging Het
Cpq T A 15: 33,290,186 probably null Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
Dst A G 1: 34,179,684 probably null Het
Eif2b3 T C 4: 117,044,566 V142A probably benign Het
Fat3 A T 9: 15,998,372 N2111K probably damaging Het
Fbxo31 C A 8: 121,578,459 E99D possibly damaging Het
Fgfr2 T C 7: 130,261,757 E34G probably damaging Het
Flvcr2 T C 12: 85,747,420 V190A possibly damaging Het
Herc2 T C 7: 56,194,403 probably null Het
Igkv3-2 A C 6: 70,699,033 M109L probably benign Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kif13b C T 14: 64,767,619 T1120I probably benign Het
Kmt2c A G 5: 25,310,835 I2670T possibly damaging Het
Lcp2 A G 11: 34,082,501 M360V probably benign Het
Ldlrad4 A G 18: 68,235,780 S103G probably benign Het
Loxl4 T C 19: 42,608,270 K88E probably damaging Het
Ltbp2 C A 12: 84,853,912 R192L probably damaging Het
Mast2 C A 4: 116,317,732 G475V probably damaging Het
Meis1 A C 11: 18,905,631 probably null Het
Myo5b C T 18: 74,770,385 A1824V probably benign Het
Nectin3 C T 16: 46,458,124 V303M probably benign Het
Olfr472 T C 7: 107,902,950 S78P possibly damaging Het
Peak1 T C 9: 56,258,211 N811S probably benign Het
Pik3ca C T 3: 32,462,821 A1066V probably benign Het
Rnf103 A G 6: 71,505,824 T153A possibly damaging Het
Sacs G A 14: 61,211,160 V3552I probably damaging Het
Sgca A T 11: 94,972,028 N109K probably damaging Het
Speg T A 1: 75,426,875 M2621K probably benign Het
Stfa2l1 T C 16: 36,156,901 I22T probably damaging Het
Tbpl2 G A 2: 24,094,703 P144L probably benign Het
Tmem219 T C 7: 126,896,826 N119S possibly damaging Het
Ush2a A G 1: 188,910,887 T4149A probably benign Het
Wdr46 C A 17: 33,941,852 P197T probably damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Other mutations in Mroh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Mroh3 UTSW 1 136190803 missense probably benign 0.00
R0507:Mroh3 UTSW 1 136190980 missense probably damaging 1.00
R0638:Mroh3 UTSW 1 136191002 missense probably damaging 1.00
R0742:Mroh3 UTSW 1 136190980 missense probably damaging 1.00
R1728:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1729:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1730:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1739:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1762:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1783:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1784:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1785:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1862:Mroh3 UTSW 1 136185988 missense probably benign 0.01
R1883:Mroh3 UTSW 1 136206993 missense probably damaging 1.00
R2166:Mroh3 UTSW 1 136186053 missense probably benign 0.03
R2566:Mroh3 UTSW 1 136198126 missense probably damaging 1.00
R3713:Mroh3 UTSW 1 136185976 missense probably benign 0.01
R3788:Mroh3 UTSW 1 136185475 missense probably damaging 1.00
R4672:Mroh3 UTSW 1 136190975 missense probably benign 0.09
R4747:Mroh3 UTSW 1 136185499 missense probably benign 0.00
R4855:Mroh3 UTSW 1 136200939 critical splice donor site probably null
R5171:Mroh3 UTSW 1 136191656 missense possibly damaging 0.82
R5296:Mroh3 UTSW 1 136196323 missense probably damaging 0.98
R5869:Mroh3 UTSW 1 136186123 missense probably benign
R6531:Mroh3 UTSW 1 136184353 missense probably benign 0.01
R6675:Mroh3 UTSW 1 136190812 missense possibly damaging 0.65
R7015:Mroh3 UTSW 1 136183331 missense probably damaging 1.00
R7587:Mroh3 UTSW 1 136190998 missense probably benign 0.09
R7657:Mroh3 UTSW 1 136181794 missense possibly damaging 0.92
Z1177:Mroh3 UTSW 1 136192136 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTATTAGGCCCAGGACAAACC -3'
(R):5'- AAGTTCGCTGTAGCTTCCTC -3'

Sequencing Primer
(F):5'- CCCAAGAACAAATTGAGCTTCTTG -3'
(R):5'- CCTTCTGATTGTCCAGCTAGG -3'
Posted On2018-06-06