Incidental Mutation 'R6347:Pik3ca'
ID520050
Institutional Source Beutler Lab
Gene Symbol Pik3ca
Ensembl Gene ENSMUSG00000027665
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha
SynonymscaPI3K, 6330412C24Rik, p110alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6347 (G1)
Quality Score220.009
Status Validated
Chromosome3
Chromosomal Location32397671-32468486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32462821 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1066 (A1066V)
Ref Sequence ENSEMBL: ENSMUSP00000103878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]
Predicted Effect probably benign
Transcript: ENSMUST00000029201
AA Change: A1066V

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: A1066V

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108242
AA Change: A944V

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: A944V

DomainStartEndE-ValueType
PI3K_rbd 51 170 5e-47 SMART
PI3K_C2 200 303 2.39e-35 SMART
C2 211 319 3.95e-1 SMART
PI3Ka 396 582 8.35e-99 SMART
Blast:PI3Kc 611 644 1e-11 BLAST
PI3Kc 676 943 8.82e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108243
AA Change: A1066V

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: A1066V

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195230
Meta Mutation Damage Score 0.1179 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G T 2: 173,527,915 R74L possibly damaging Het
Atat1 A G 17: 35,910,029 F3L probably damaging Het
Atf7 T A 15: 102,546,479 M285L possibly damaging Het
Bcl7b T C 5: 135,180,533 S95P possibly damaging Het
Cald1 A C 6: 34,765,046 K453Q probably damaging Het
Cog4 A T 8: 110,880,643 I580F probably damaging Het
Cpq T A 15: 33,290,186 probably null Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
Dst A G 1: 34,179,684 probably null Het
Eif2b3 T C 4: 117,044,566 V142A probably benign Het
Fat3 A T 9: 15,998,372 N2111K probably damaging Het
Fbxo31 C A 8: 121,578,459 E99D possibly damaging Het
Fgfr2 T C 7: 130,261,757 E34G probably damaging Het
Flvcr2 T C 12: 85,747,420 V190A possibly damaging Het
Herc2 T C 7: 56,194,403 probably null Het
Igkv3-2 A C 6: 70,699,033 M109L probably benign Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kif13b C T 14: 64,767,619 T1120I probably benign Het
Kmt2c A G 5: 25,310,835 I2670T possibly damaging Het
Lcp2 A G 11: 34,082,501 M360V probably benign Het
Ldlrad4 A G 18: 68,235,780 S103G probably benign Het
Loxl4 T C 19: 42,608,270 K88E probably damaging Het
Ltbp2 C A 12: 84,853,912 R192L probably damaging Het
Mast2 C A 4: 116,317,732 G475V probably damaging Het
Meis1 A C 11: 18,905,631 probably null Het
Mroh3 T C 1: 136,200,937 probably null Het
Myo5b C T 18: 74,770,385 A1824V probably benign Het
Nectin3 C T 16: 46,458,124 V303M probably benign Het
Olfr472 T C 7: 107,902,950 S78P possibly damaging Het
Peak1 T C 9: 56,258,211 N811S probably benign Het
Rnf103 A G 6: 71,505,824 T153A possibly damaging Het
Sacs G A 14: 61,211,160 V3552I probably damaging Het
Sgca A T 11: 94,972,028 N109K probably damaging Het
Speg T A 1: 75,426,875 M2621K probably benign Het
Stfa2l1 T C 16: 36,156,901 I22T probably damaging Het
Tbpl2 G A 2: 24,094,703 P144L probably benign Het
Tmem219 T C 7: 126,896,826 N119S possibly damaging Het
Ush2a A G 1: 188,910,887 T4149A probably benign Het
Wdr46 C A 17: 33,941,852 P197T probably damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Other mutations in Pik3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pik3ca APN 3 32462584 missense probably damaging 1.00
IGL01894:Pik3ca APN 3 32450026 missense possibly damaging 0.91
IGL03118:Pik3ca APN 3 32459935 missense probably damaging 1.00
IGL03184:Pik3ca APN 3 32439886 missense probably benign 0.27
IGL03401:Pik3ca APN 3 32437814 splice site probably null
Peninsular UTSW 3 32462821 missense probably benign 0.38
R0084:Pik3ca UTSW 3 32462788 missense possibly damaging 0.78
R0116:Pik3ca UTSW 3 32459945 missense probably damaging 1.00
R0278:Pik3ca UTSW 3 32439753 missense possibly damaging 0.60
R0513:Pik3ca UTSW 3 32461511 missense probably damaging 1.00
R0543:Pik3ca UTSW 3 32450261 critical splice acceptor site probably null
R0622:Pik3ca UTSW 3 32436552 missense probably damaging 1.00
R0630:Pik3ca UTSW 3 32450027 missense possibly damaging 0.91
R1193:Pik3ca UTSW 3 32456093 missense probably damaging 0.99
R1292:Pik3ca UTSW 3 32454420 missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32461841 missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32461841 missense probably damaging 1.00
R1869:Pik3ca UTSW 3 32450350 missense probably damaging 0.99
R1962:Pik3ca UTSW 3 32443867 missense probably benign 0.27
R1969:Pik3ca UTSW 3 32451754 critical splice acceptor site probably null
R2006:Pik3ca UTSW 3 32450057 missense probably damaging 1.00
R2264:Pik3ca UTSW 3 32437927 missense possibly damaging 0.65
R2366:Pik3ca UTSW 3 32462794 nonsense probably null
R2680:Pik3ca UTSW 3 32436548 nonsense probably null
R2680:Pik3ca UTSW 3 32443885 missense probably benign 0.00
R3001:Pik3ca UTSW 3 32462797 missense probably damaging 1.00
R3002:Pik3ca UTSW 3 32462797 missense probably damaging 1.00
R4303:Pik3ca UTSW 3 32439935 nonsense probably null
R4416:Pik3ca UTSW 3 32461530 missense probably damaging 0.99
R4758:Pik3ca UTSW 3 32437978 missense probably benign 0.20
R4822:Pik3ca UTSW 3 32437982 missense probably benign 0.04
R4856:Pik3ca UTSW 3 32437163 missense probably damaging 1.00
R4886:Pik3ca UTSW 3 32437163 missense probably damaging 1.00
R5297:Pik3ca UTSW 3 32450053 missense probably damaging 1.00
R5636:Pik3ca UTSW 3 32461560 missense probably damaging 1.00
R5663:Pik3ca UTSW 3 32462779 missense probably damaging 1.00
R6249:Pik3ca UTSW 3 32461563 missense probably damaging 1.00
R6264:Pik3ca UTSW 3 32440714 critical splice donor site probably null
R6538:Pik3ca UTSW 3 32439704 missense probably damaging 1.00
R7020:Pik3ca UTSW 3 32436279 missense probably damaging 0.97
R7720:Pik3ca UTSW 3 32436218 missense probably damaging 1.00
R7864:Pik3ca UTSW 3 32443613 nonsense probably null
R7947:Pik3ca UTSW 3 32443613 nonsense probably null
Z1177:Pik3ca UTSW 3 32437967 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGCCAATCTCTTCATCAAC -3'
(R):5'- ATCAAACCCTGCTTGCGTGTAC -3'

Sequencing Primer
(F):5'- ATGCTTGGCTCTGGAATGCC -3'
(R):5'- CAGTGTTTCAATTATAGAGCACGTTG -3'
Posted On2018-06-06