Incidental Mutation 'R6347:Pik3ca'
ID 520050
Institutional Source Beutler Lab
Gene Symbol Pik3ca
Ensembl Gene ENSMUSG00000027665
Gene Name phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha
Synonyms 6330412C24Rik, caPI3K, p110alpha
MMRRC Submission 044501-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6347 (G1)
Quality Score 220.009
Status Validated
Chromosome 3
Chromosomal Location 32451203-32520256 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32516970 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1066 (A1066V)
Ref Sequence ENSEMBL: ENSMUSP00000103878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]
AlphaFold P42337
Predicted Effect probably benign
Transcript: ENSMUST00000029201
AA Change: A1066V

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: A1066V

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108242
AA Change: A944V

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: A944V

DomainStartEndE-ValueType
PI3K_rbd 51 170 5e-47 SMART
PI3K_C2 200 303 2.39e-35 SMART
C2 211 319 3.95e-1 SMART
PI3Ka 396 582 8.35e-99 SMART
Blast:PI3Kc 611 644 1e-11 BLAST
PI3Kc 676 943 8.82e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108243
AA Change: A1066V

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: A1066V

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195230
Meta Mutation Damage Score 0.1179 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atat1 A G 17: 36,220,921 (GRCm39) F3L probably damaging Het
Atf7 T A 15: 102,454,914 (GRCm39) M285L possibly damaging Het
Bcl7b T C 5: 135,209,387 (GRCm39) S95P possibly damaging Het
Cald1 A C 6: 34,741,981 (GRCm39) K453Q probably damaging Het
Cimip1 G T 2: 173,369,708 (GRCm39) R74L possibly damaging Het
Cog4 A T 8: 111,607,275 (GRCm39) I580F probably damaging Het
Cpq T A 15: 33,290,332 (GRCm39) probably null Het
Csf2rb G A 15: 78,229,752 (GRCm39) D440N probably damaging Het
Dst A G 1: 34,218,765 (GRCm39) probably null Het
Eif2b3 T C 4: 116,901,763 (GRCm39) V142A probably benign Het
Fat3 A T 9: 15,909,668 (GRCm39) N2111K probably damaging Het
Fbxo31 C A 8: 122,305,198 (GRCm39) E99D possibly damaging Het
Fgfr2 T C 7: 129,863,487 (GRCm39) E34G probably damaging Het
Flvcr2 T C 12: 85,794,194 (GRCm39) V190A possibly damaging Het
Herc2 T C 7: 55,844,151 (GRCm39) probably null Het
Igkv3-2 A C 6: 70,676,017 (GRCm39) M109L probably benign Het
Il36rn G A 2: 24,169,726 (GRCm39) A29T probably damaging Het
Kif13b C T 14: 65,005,068 (GRCm39) T1120I probably benign Het
Kmt2c A G 5: 25,515,833 (GRCm39) I2670T possibly damaging Het
Lcp2 A G 11: 34,032,501 (GRCm39) M360V probably benign Het
Ldlrad4 A G 18: 68,368,851 (GRCm39) S103G probably benign Het
Loxl4 T C 19: 42,596,709 (GRCm39) K88E probably damaging Het
Ltbp2 C A 12: 84,900,686 (GRCm39) R192L probably damaging Het
Mast2 C A 4: 116,174,929 (GRCm39) G475V probably damaging Het
Meis1 A C 11: 18,855,631 (GRCm39) probably null Het
Mroh3 T C 1: 136,128,675 (GRCm39) probably null Het
Myo5b C T 18: 74,903,456 (GRCm39) A1824V probably benign Het
Nectin3 C T 16: 46,278,487 (GRCm39) V303M probably benign Het
Or5p52 T C 7: 107,502,157 (GRCm39) S78P possibly damaging Het
Peak1 T C 9: 56,165,495 (GRCm39) N811S probably benign Het
Rnf103 A G 6: 71,482,808 (GRCm39) T153A possibly damaging Het
Sacs G A 14: 61,448,609 (GRCm39) V3552I probably damaging Het
Sgca A T 11: 94,862,854 (GRCm39) N109K probably damaging Het
Speg T A 1: 75,403,519 (GRCm39) M2621K probably benign Het
Stfa2l1 T C 16: 35,977,271 (GRCm39) I22T probably damaging Het
Tbpl2 G A 2: 23,984,715 (GRCm39) P144L probably benign Het
Tmem219 T C 7: 126,495,998 (GRCm39) N119S possibly damaging Het
Ush2a A G 1: 188,643,084 (GRCm39) T4149A probably benign Het
Wdr46 C A 17: 34,160,826 (GRCm39) P197T probably damaging Het
Wee2 C T 6: 40,432,039 (GRCm39) R203C probably damaging Het
Other mutations in Pik3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pik3ca APN 3 32,516,733 (GRCm39) missense probably damaging 1.00
IGL01894:Pik3ca APN 3 32,504,175 (GRCm39) missense possibly damaging 0.91
IGL03118:Pik3ca APN 3 32,514,084 (GRCm39) missense probably damaging 1.00
IGL03184:Pik3ca APN 3 32,494,035 (GRCm39) missense probably benign 0.27
IGL03401:Pik3ca APN 3 32,491,963 (GRCm39) splice site probably null
Interrupted UTSW 3 32,492,211 (GRCm39) missense probably damaging 1.00
Lilfella UTSW 3 32,508,569 (GRCm39) missense probably damaging 1.00
Peninsular UTSW 3 32,516,970 (GRCm39) missense probably benign 0.38
Severed UTSW 3 32,492,076 (GRCm39) missense possibly damaging 0.65
R0084:Pik3ca UTSW 3 32,516,937 (GRCm39) missense possibly damaging 0.78
R0116:Pik3ca UTSW 3 32,514,094 (GRCm39) missense probably damaging 1.00
R0278:Pik3ca UTSW 3 32,493,902 (GRCm39) missense possibly damaging 0.60
R0513:Pik3ca UTSW 3 32,515,660 (GRCm39) missense probably damaging 1.00
R0543:Pik3ca UTSW 3 32,504,410 (GRCm39) critical splice acceptor site probably null
R0622:Pik3ca UTSW 3 32,490,701 (GRCm39) missense probably damaging 1.00
R0630:Pik3ca UTSW 3 32,504,176 (GRCm39) missense possibly damaging 0.91
R1193:Pik3ca UTSW 3 32,510,242 (GRCm39) missense probably damaging 0.99
R1292:Pik3ca UTSW 3 32,508,569 (GRCm39) missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32,515,990 (GRCm39) missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32,515,990 (GRCm39) missense probably damaging 1.00
R1869:Pik3ca UTSW 3 32,504,499 (GRCm39) missense probably damaging 0.99
R1962:Pik3ca UTSW 3 32,498,016 (GRCm39) missense probably benign 0.27
R1969:Pik3ca UTSW 3 32,505,903 (GRCm39) critical splice acceptor site probably null
R2006:Pik3ca UTSW 3 32,504,206 (GRCm39) missense probably damaging 1.00
R2264:Pik3ca UTSW 3 32,492,076 (GRCm39) missense possibly damaging 0.65
R2366:Pik3ca UTSW 3 32,516,943 (GRCm39) nonsense probably null
R2680:Pik3ca UTSW 3 32,498,034 (GRCm39) missense probably benign 0.00
R2680:Pik3ca UTSW 3 32,490,697 (GRCm39) nonsense probably null
R3001:Pik3ca UTSW 3 32,516,946 (GRCm39) missense probably damaging 1.00
R3002:Pik3ca UTSW 3 32,516,946 (GRCm39) missense probably damaging 1.00
R4303:Pik3ca UTSW 3 32,494,084 (GRCm39) nonsense probably null
R4416:Pik3ca UTSW 3 32,515,679 (GRCm39) missense probably damaging 0.99
R4758:Pik3ca UTSW 3 32,492,127 (GRCm39) missense probably benign 0.20
R4822:Pik3ca UTSW 3 32,492,131 (GRCm39) missense probably benign 0.04
R4856:Pik3ca UTSW 3 32,491,312 (GRCm39) missense probably damaging 1.00
R4886:Pik3ca UTSW 3 32,491,312 (GRCm39) missense probably damaging 1.00
R5297:Pik3ca UTSW 3 32,504,202 (GRCm39) missense probably damaging 1.00
R5636:Pik3ca UTSW 3 32,515,709 (GRCm39) missense probably damaging 1.00
R5663:Pik3ca UTSW 3 32,516,928 (GRCm39) missense probably damaging 1.00
R6249:Pik3ca UTSW 3 32,515,712 (GRCm39) missense probably damaging 1.00
R6264:Pik3ca UTSW 3 32,494,863 (GRCm39) critical splice donor site probably null
R6538:Pik3ca UTSW 3 32,493,853 (GRCm39) missense probably damaging 1.00
R7020:Pik3ca UTSW 3 32,490,428 (GRCm39) missense probably damaging 0.97
R7720:Pik3ca UTSW 3 32,490,367 (GRCm39) missense probably damaging 1.00
R7864:Pik3ca UTSW 3 32,497,762 (GRCm39) nonsense probably null
R8218:Pik3ca UTSW 3 32,491,996 (GRCm39) missense possibly damaging 0.74
R8478:Pik3ca UTSW 3 32,505,997 (GRCm39) missense probably benign
R9100:Pik3ca UTSW 3 32,514,168 (GRCm39) missense probably damaging 1.00
R9169:Pik3ca UTSW 3 32,503,755 (GRCm39) critical splice donor site probably null
R9255:Pik3ca UTSW 3 32,496,981 (GRCm39) critical splice donor site probably null
R9267:Pik3ca UTSW 3 32,492,211 (GRCm39) missense probably damaging 1.00
R9278:Pik3ca UTSW 3 32,508,587 (GRCm39) missense probably damaging 1.00
R9501:Pik3ca UTSW 3 32,504,062 (GRCm39) missense probably damaging 1.00
R9555:Pik3ca UTSW 3 32,505,916 (GRCm39) missense probably damaging 1.00
Z1177:Pik3ca UTSW 3 32,492,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGCCAATCTCTTCATCAAC -3'
(R):5'- ATCAAACCCTGCTTGCGTGTAC -3'

Sequencing Primer
(F):5'- ATGCTTGGCTCTGGAATGCC -3'
(R):5'- CAGTGTTTCAATTATAGAGCACGTTG -3'
Posted On 2018-06-06