Incidental Mutation 'R6347:Bcl7b'
ID520054
Institutional Source Beutler Lab
Gene Symbol Bcl7b
Ensembl Gene ENSMUSG00000029681
Gene NameB cell CLL/lymphoma 7B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6347 (G1)
Quality Score199.009
Status Validated
Chromosome5
Chromosomal Location135168283-135181855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135180533 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 95 (S95P)
Ref Sequence ENSEMBL: ENSMUSP00000106819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031692] [ENSMUST00000111188] [ENSMUST00000202606]
Predicted Effect probably benign
Transcript: ENSMUST00000031692
AA Change: S152P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000031692
Gene: ENSMUSG00000029681
AA Change: S152P

DomainStartEndE-ValueType
Pfam:BCL_N 3 51 1.5e-31 PFAM
low complexity region 54 62 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111188
AA Change: S95P

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106819
Gene: ENSMUSG00000029681
AA Change: S95P

DomainStartEndE-ValueType
Pfam:BCL_N 2 53 5.2e-32 PFAM
low complexity region 54 62 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145329
Predicted Effect possibly damaging
Transcript: ENSMUST00000202606
AA Change: S126P

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144538
Gene: ENSMUSG00000029681
AA Change: S126P

DomainStartEndE-ValueType
Pfam:BCL_N 2 25 3.8e-11 PFAM
low complexity region 28 36 N/A INTRINSIC
low complexity region 81 97 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BCL7 family including BCL7A, BCL7B and BCL7C proteins. This member is BCL7B, which contains a region that is highly similar to the N-terminal segment of BCL7A or BCL7C proteins. The BCL7A protein is encoded by the gene known to be directly involved in a three-way gene translocation in a Burkitt lymphoma cell line. This gene is located at a chromosomal region commonly deleted in Williams syndrome. This gene is highly conserved from C. elegans to human. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G T 2: 173,527,915 R74L possibly damaging Het
Atat1 A G 17: 35,910,029 F3L probably damaging Het
Atf7 T A 15: 102,546,479 M285L possibly damaging Het
Cald1 A C 6: 34,765,046 K453Q probably damaging Het
Cog4 A T 8: 110,880,643 I580F probably damaging Het
Cpq T A 15: 33,290,186 probably null Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
Dst A G 1: 34,179,684 probably null Het
Eif2b3 T C 4: 117,044,566 V142A probably benign Het
Fat3 A T 9: 15,998,372 N2111K probably damaging Het
Fbxo31 C A 8: 121,578,459 E99D possibly damaging Het
Fgfr2 T C 7: 130,261,757 E34G probably damaging Het
Flvcr2 T C 12: 85,747,420 V190A possibly damaging Het
Herc2 T C 7: 56,194,403 probably null Het
Igkv3-2 A C 6: 70,699,033 M109L probably benign Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kif13b C T 14: 64,767,619 T1120I probably benign Het
Kmt2c A G 5: 25,310,835 I2670T possibly damaging Het
Lcp2 A G 11: 34,082,501 M360V probably benign Het
Ldlrad4 A G 18: 68,235,780 S103G probably benign Het
Loxl4 T C 19: 42,608,270 K88E probably damaging Het
Ltbp2 C A 12: 84,853,912 R192L probably damaging Het
Mast2 C A 4: 116,317,732 G475V probably damaging Het
Meis1 A C 11: 18,905,631 probably null Het
Mroh3 T C 1: 136,200,937 probably null Het
Myo5b C T 18: 74,770,385 A1824V probably benign Het
Nectin3 C T 16: 46,458,124 V303M probably benign Het
Olfr472 T C 7: 107,902,950 S78P possibly damaging Het
Peak1 T C 9: 56,258,211 N811S probably benign Het
Pik3ca C T 3: 32,462,821 A1066V probably benign Het
Rnf103 A G 6: 71,505,824 T153A possibly damaging Het
Sacs G A 14: 61,211,160 V3552I probably damaging Het
Sgca A T 11: 94,972,028 N109K probably damaging Het
Speg T A 1: 75,426,875 M2621K probably benign Het
Stfa2l1 T C 16: 36,156,901 I22T probably damaging Het
Tbpl2 G A 2: 24,094,703 P144L probably benign Het
Tmem219 T C 7: 126,896,826 N119S possibly damaging Het
Ush2a A G 1: 188,910,887 T4149A probably benign Het
Wdr46 C A 17: 33,941,852 P197T probably damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Other mutations in Bcl7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Bcl7b APN 5 135180096 missense probably damaging 1.00
R0468:Bcl7b UTSW 5 135180883 missense probably benign 0.18
R3732:Bcl7b UTSW 5 135180913 missense probably benign 0.00
R3732:Bcl7b UTSW 5 135180913 missense probably benign 0.00
R3733:Bcl7b UTSW 5 135180913 missense probably benign 0.00
R4857:Bcl7b UTSW 5 135173179 makesense probably null
R5020:Bcl7b UTSW 5 135171163 critical splice donor site probably null
R6391:Bcl7b UTSW 5 135180025 missense probably damaging 1.00
R7791:Bcl7b UTSW 5 135171114 missense probably damaging 0.99
R7879:Bcl7b UTSW 5 135177132 missense possibly damaging 0.84
R7962:Bcl7b UTSW 5 135177132 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AGCTCCCAGTGTTTGCCATG -3'
(R):5'- ACCAGTGACTGTTTTCCCAG -3'

Sequencing Primer
(F):5'- ATGGTGGCCCTCTGTGATCC -3'
(R):5'- AGTGACTGTTTTCCCAGCAGAC -3'
Posted On2018-06-06