Incidental Mutation 'R6347:Wee2'
ID520056
Institutional Source Beutler Lab
Gene Symbol Wee2
Ensembl Gene ENSMUSG00000037159
Gene NameWEE1 homolog 2 (S. pombe)
SynonymsLOC381759, Wee1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6347 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location40439088-40466813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40455105 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 203 (R203C)
Ref Sequence ENSEMBL: ENSMUSP00000144628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038907] [ENSMUST00000202464]
Predicted Effect probably damaging
Transcript: ENSMUST00000038907
AA Change: R203C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038754
Gene: ENSMUSG00000037159
AA Change: R203C

DomainStartEndE-ValueType
low complexity region 117 128 N/A INTRINSIC
Pfam:Pkinase 208 481 3.6e-51 PFAM
Pfam:Pkinase_Tyr 209 478 9.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202464
AA Change: R203C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144628
Gene: ENSMUSG00000037159
AA Change: R203C

DomainStartEndE-ValueType
low complexity region 117 128 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G T 2: 173,527,915 R74L possibly damaging Het
Atat1 A G 17: 35,910,029 F3L probably damaging Het
Atf7 T A 15: 102,546,479 M285L possibly damaging Het
Bcl7b T C 5: 135,180,533 S95P possibly damaging Het
Cald1 A C 6: 34,765,046 K453Q probably damaging Het
Cog4 A T 8: 110,880,643 I580F probably damaging Het
Cpq T A 15: 33,290,186 probably null Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
Dst A G 1: 34,179,684 probably null Het
Eif2b3 T C 4: 117,044,566 V142A probably benign Het
Fat3 A T 9: 15,998,372 N2111K probably damaging Het
Fbxo31 C A 8: 121,578,459 E99D possibly damaging Het
Fgfr2 T C 7: 130,261,757 E34G probably damaging Het
Flvcr2 T C 12: 85,747,420 V190A possibly damaging Het
Herc2 T C 7: 56,194,403 probably null Het
Igkv3-2 A C 6: 70,699,033 M109L probably benign Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kif13b C T 14: 64,767,619 T1120I probably benign Het
Kmt2c A G 5: 25,310,835 I2670T possibly damaging Het
Lcp2 A G 11: 34,082,501 M360V probably benign Het
Ldlrad4 A G 18: 68,235,780 S103G probably benign Het
Loxl4 T C 19: 42,608,270 K88E probably damaging Het
Ltbp2 C A 12: 84,853,912 R192L probably damaging Het
Mast2 C A 4: 116,317,732 G475V probably damaging Het
Meis1 A C 11: 18,905,631 probably null Het
Mroh3 T C 1: 136,200,937 probably null Het
Myo5b C T 18: 74,770,385 A1824V probably benign Het
Nectin3 C T 16: 46,458,124 V303M probably benign Het
Olfr472 T C 7: 107,902,950 S78P possibly damaging Het
Peak1 T C 9: 56,258,211 N811S probably benign Het
Pik3ca C T 3: 32,462,821 A1066V probably benign Het
Rnf103 A G 6: 71,505,824 T153A possibly damaging Het
Sacs G A 14: 61,211,160 V3552I probably damaging Het
Sgca A T 11: 94,972,028 N109K probably damaging Het
Speg T A 1: 75,426,875 M2621K probably benign Het
Stfa2l1 T C 16: 36,156,901 I22T probably damaging Het
Tbpl2 G A 2: 24,094,703 P144L probably benign Het
Tmem219 T C 7: 126,896,826 N119S possibly damaging Het
Ush2a A G 1: 188,910,887 T4149A probably benign Het
Wdr46 C A 17: 33,941,852 P197T probably damaging Het
Other mutations in Wee2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wee2 APN 6 40462061 missense probably damaging 1.00
IGL01096:Wee2 APN 6 40463253 missense probably benign 0.00
IGL01978:Wee2 APN 6 40455153 missense probably damaging 1.00
IGL03026:Wee2 APN 6 40461981 missense probably benign 0.00
IGL03091:Wee2 APN 6 40462034 missense probably benign 0.02
IGL03350:Wee2 APN 6 40449731 missense probably damaging 1.00
IGL03352:Wee2 APN 6 40452655 critical splice donor site probably null
R0420:Wee2 UTSW 6 40456995 missense probably benign 0.04
R0506:Wee2 UTSW 6 40463253 missense probably benign 0.04
R1205:Wee2 UTSW 6 40443941 start gained probably benign
R1702:Wee2 UTSW 6 40464201 missense probably benign 0.04
R3982:Wee2 UTSW 6 40455241 missense possibly damaging 0.86
R3983:Wee2 UTSW 6 40455241 missense possibly damaging 0.86
R5946:Wee2 UTSW 6 40463212 missense probably null 1.00
R6020:Wee2 UTSW 6 40449620 splice site probably null
R6127:Wee2 UTSW 6 40449767 missense probably damaging 1.00
R6189:Wee2 UTSW 6 40449683 missense probably damaging 1.00
R6342:Wee2 UTSW 6 40444255 missense probably benign 0.05
R6350:Wee2 UTSW 6 40455105 missense probably damaging 1.00
R6513:Wee2 UTSW 6 40452619 missense probably benign 0.00
R7091:Wee2 UTSW 6 40462002 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGACTTGTAAGGCTACAAAGGAC -3'
(R):5'- AGTTACCAAATCCAAGCCTGTTC -3'

Sequencing Primer
(F):5'- ACATAGGTGTGGCCAGCC -3'
(R):5'- GCCTGTTCATCCAATACTTTTCAAAG -3'
Posted On2018-06-06