Incidental Mutation 'R6347:Tmem219'
ID520061
Institutional Source Beutler Lab
Gene Symbol Tmem219
Ensembl Gene ENSMUSG00000060538
Gene Nametransmembrane protein 219
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6347 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126886171-126922917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126896826 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 119 (N119S)
Ref Sequence ENSEMBL: ENSMUSP00000116806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032926] [ENSMUST00000119781] [ENSMUST00000120007] [ENSMUST00000121532] [ENSMUST00000121612] [ENSMUST00000134134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032926
AA Change: N93S

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032926
Gene: ENSMUSG00000060538
AA Change: N93S

DomainStartEndE-ValueType
Pfam:TMEM219 10 193 4.8e-51 PFAM
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119781
AA Change: N118S

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114040
Gene: ENSMUSG00000060538
AA Change: N118S

DomainStartEndE-ValueType
Pfam:TMEM219 35 218 6.5e-51 PFAM
transmembrane domain 230 252 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120007
AA Change: N125S

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113647
Gene: ENSMUSG00000060538
AA Change: N125S

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
Pfam:TMEM219 42 119 1.1e-12 PFAM
Pfam:TMEM219 116 216 1.6e-9 PFAM
low complexity region 217 232 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121532
AA Change: N93S

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112485
Gene: ENSMUSG00000060538
AA Change: N93S

DomainStartEndE-ValueType
Pfam:TMEM219 10 193 4.8e-51 PFAM
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121612
AA Change: N22S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113260
Gene: ENSMUSG00000060538
AA Change: N22S

DomainStartEndE-ValueType
Pfam:TMEM219 1 122 1e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134134
AA Change: N119S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116806
Gene: ENSMUSG00000060538
AA Change: N119S

DomainStartEndE-ValueType
Pfam:TMEM219 36 219 3.3e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175690
Predicted Effect unknown
Transcript: ENSMUST00000177004
AA Change: N17S
Meta Mutation Damage Score 0.4160 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit attenuated IL13 responsiveness, increased susceptibility to exposure to 100% oxygen, and reduced lung metastasis of B16-F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G T 2: 173,527,915 R74L possibly damaging Het
Atat1 A G 17: 35,910,029 F3L probably damaging Het
Atf7 T A 15: 102,546,479 M285L possibly damaging Het
Bcl7b T C 5: 135,180,533 S95P possibly damaging Het
Cald1 A C 6: 34,765,046 K453Q probably damaging Het
Cog4 A T 8: 110,880,643 I580F probably damaging Het
Cpq T A 15: 33,290,186 probably null Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
Dst A G 1: 34,179,684 probably null Het
Eif2b3 T C 4: 117,044,566 V142A probably benign Het
Fat3 A T 9: 15,998,372 N2111K probably damaging Het
Fbxo31 C A 8: 121,578,459 E99D possibly damaging Het
Fgfr2 T C 7: 130,261,757 E34G probably damaging Het
Flvcr2 T C 12: 85,747,420 V190A possibly damaging Het
Herc2 T C 7: 56,194,403 probably null Het
Igkv3-2 A C 6: 70,699,033 M109L probably benign Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kif13b C T 14: 64,767,619 T1120I probably benign Het
Kmt2c A G 5: 25,310,835 I2670T possibly damaging Het
Lcp2 A G 11: 34,082,501 M360V probably benign Het
Ldlrad4 A G 18: 68,235,780 S103G probably benign Het
Loxl4 T C 19: 42,608,270 K88E probably damaging Het
Ltbp2 C A 12: 84,853,912 R192L probably damaging Het
Mast2 C A 4: 116,317,732 G475V probably damaging Het
Meis1 A C 11: 18,905,631 probably null Het
Mroh3 T C 1: 136,200,937 probably null Het
Myo5b C T 18: 74,770,385 A1824V probably benign Het
Nectin3 C T 16: 46,458,124 V303M probably benign Het
Olfr472 T C 7: 107,902,950 S78P possibly damaging Het
Peak1 T C 9: 56,258,211 N811S probably benign Het
Pik3ca C T 3: 32,462,821 A1066V probably benign Het
Rnf103 A G 6: 71,505,824 T153A possibly damaging Het
Sacs G A 14: 61,211,160 V3552I probably damaging Het
Sgca A T 11: 94,972,028 N109K probably damaging Het
Speg T A 1: 75,426,875 M2621K probably benign Het
Stfa2l1 T C 16: 36,156,901 I22T probably damaging Het
Tbpl2 G A 2: 24,094,703 P144L probably benign Het
Ush2a A G 1: 188,910,887 T4149A probably benign Het
Wdr46 C A 17: 33,941,852 P197T probably damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Other mutations in Tmem219
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Tmem219 APN 7 126897138 missense probably damaging 1.00
IGL02186:Tmem219 APN 7 126896816 missense probably benign 0.02
IGL02742:Tmem219 APN 7 126897048 missense probably damaging 1.00
IGL02836:Tmem219 APN 7 126888949 missense probably benign 0.33
R1971:Tmem219 UTSW 7 126897250 missense probably benign 0.18
R2412:Tmem219 UTSW 7 126896767 missense probably damaging 0.99
R7078:Tmem219 UTSW 7 126891803 missense probably damaging 1.00
R7095:Tmem219 UTSW 7 126891756 missense probably damaging 0.99
R7385:Tmem219 UTSW 7 126896775 missense probably damaging 0.99
Z1088:Tmem219 UTSW 7 126891674 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGTCACTAAGGTGTACGGATGTG -3'
(R):5'- CCTGACATTCCCCAGGTAAGTAC -3'

Sequencing Primer
(F):5'- ACGGATGTGTCCAAGTTAGCAGTC -3'
(R):5'- GGTGCTCACCCTTGTGG -3'
Posted On2018-06-06