Incidental Mutation 'R6347:Peak1'
ID520065
Institutional Source Beutler Lab
Gene Symbol Peak1
Ensembl Gene ENSMUSG00000074305
Gene Namepseudopodium-enriched atypical kinase 1
SynonymsC230081A13Rik, NKF3 kinase family member, 1110049L02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R6347 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location56201126-56418067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56258211 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 811 (N811S)
Ref Sequence ENSEMBL: ENSMUSP00000109901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000186735]
Predicted Effect probably benign
Transcript: ENSMUST00000061552
AA Change: N811S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305
AA Change: N811S

DomainStartEndE-ValueType
low complexity region 247 259 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Pfam:Pkinase_Tyr 1437 1649 1.5e-6 PFAM
Pfam:Pkinase 1440 1651 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181444
Predicted Effect probably benign
Transcript: ENSMUST00000186735
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G T 2: 173,527,915 R74L possibly damaging Het
Atat1 A G 17: 35,910,029 F3L probably damaging Het
Atf7 T A 15: 102,546,479 M285L possibly damaging Het
Bcl7b T C 5: 135,180,533 S95P possibly damaging Het
Cald1 A C 6: 34,765,046 K453Q probably damaging Het
Cog4 A T 8: 110,880,643 I580F probably damaging Het
Cpq T A 15: 33,290,186 probably null Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
Dst A G 1: 34,179,684 probably null Het
Eif2b3 T C 4: 117,044,566 V142A probably benign Het
Fat3 A T 9: 15,998,372 N2111K probably damaging Het
Fbxo31 C A 8: 121,578,459 E99D possibly damaging Het
Fgfr2 T C 7: 130,261,757 E34G probably damaging Het
Flvcr2 T C 12: 85,747,420 V190A possibly damaging Het
Herc2 T C 7: 56,194,403 probably null Het
Igkv3-2 A C 6: 70,699,033 M109L probably benign Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kif13b C T 14: 64,767,619 T1120I probably benign Het
Kmt2c A G 5: 25,310,835 I2670T possibly damaging Het
Lcp2 A G 11: 34,082,501 M360V probably benign Het
Ldlrad4 A G 18: 68,235,780 S103G probably benign Het
Loxl4 T C 19: 42,608,270 K88E probably damaging Het
Ltbp2 C A 12: 84,853,912 R192L probably damaging Het
Mast2 C A 4: 116,317,732 G475V probably damaging Het
Meis1 A C 11: 18,905,631 probably null Het
Mroh3 T C 1: 136,200,937 probably null Het
Myo5b C T 18: 74,770,385 A1824V probably benign Het
Nectin3 C T 16: 46,458,124 V303M probably benign Het
Olfr472 T C 7: 107,902,950 S78P possibly damaging Het
Pik3ca C T 3: 32,462,821 A1066V probably benign Het
Rnf103 A G 6: 71,505,824 T153A possibly damaging Het
Sacs G A 14: 61,211,160 V3552I probably damaging Het
Sgca A T 11: 94,972,028 N109K probably damaging Het
Speg T A 1: 75,426,875 M2621K probably benign Het
Stfa2l1 T C 16: 36,156,901 I22T probably damaging Het
Tbpl2 G A 2: 24,094,703 P144L probably benign Het
Tmem219 T C 7: 126,896,826 N119S possibly damaging Het
Ush2a A G 1: 188,910,887 T4149A probably benign Het
Wdr46 C A 17: 33,941,852 P197T probably damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Other mutations in Peak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Peak1 APN 9 56227326 missense probably damaging 1.00
IGL00544:Peak1 APN 9 56259978 missense probably damaging 1.00
IGL01141:Peak1 APN 9 56258527 missense probably benign 0.01
IGL01743:Peak1 APN 9 56259202 missense probably damaging 1.00
IGL01781:Peak1 APN 9 56260065 missense possibly damaging 0.92
IGL01885:Peak1 APN 9 56260104 missense probably damaging 1.00
IGL01941:Peak1 APN 9 56258775 missense probably damaging 1.00
IGL02455:Peak1 APN 9 56227473 missense possibly damaging 0.89
IGL02719:Peak1 APN 9 56227206 missense probably damaging 1.00
IGL03247:Peak1 APN 9 56257930 missense probably damaging 1.00
IGL03259:Peak1 APN 9 56259967 missense probably damaging 1.00
R0060:Peak1 UTSW 9 56227823 missense probably damaging 1.00
R0087:Peak1 UTSW 9 56258325 missense probably damaging 1.00
R0480:Peak1 UTSW 9 56258632 missense probably benign 0.00
R0569:Peak1 UTSW 9 56260089 missense probably damaging 1.00
R0605:Peak1 UTSW 9 56227098 splice site probably benign
R0865:Peak1 UTSW 9 56257832 missense probably benign 0.02
R1117:Peak1 UTSW 9 56258418 missense probably benign 0.05
R1922:Peak1 UTSW 9 56206687 missense probably damaging 1.00
R1959:Peak1 UTSW 9 56206789 missense probably damaging 1.00
R2069:Peak1 UTSW 9 56258759 missense probably damaging 1.00
R2083:Peak1 UTSW 9 56258949 missense probably damaging 1.00
R2154:Peak1 UTSW 9 56207212 missense probably damaging 1.00
R2407:Peak1 UTSW 9 56259226 missense probably damaging 1.00
R3832:Peak1 UTSW 9 56258383 missense probably benign
R3938:Peak1 UTSW 9 56260365 missense probably benign 0.01
R3964:Peak1 UTSW 9 56259979 missense probably damaging 1.00
R4192:Peak1 UTSW 9 56258741 missense probably damaging 1.00
R4381:Peak1 UTSW 9 56258427 missense probably benign 0.34
R4869:Peak1 UTSW 9 56227592 missense probably benign 0.06
R4994:Peak1 UTSW 9 56241276 missense possibly damaging 0.65
R5062:Peak1 UTSW 9 56260289 missense probably damaging 1.00
R5435:Peak1 UTSW 9 56206486 missense probably damaging 0.98
R5632:Peak1 UTSW 9 56257774 missense probably damaging 1.00
R5643:Peak1 UTSW 9 56258755 missense probably damaging 0.99
R5880:Peak1 UTSW 9 56207610 missense probably damaging 1.00
R5898:Peak1 UTSW 9 56207338 missense probably benign 0.19
R5986:Peak1 UTSW 9 56259442 missense probably benign 0.00
R6109:Peak1 UTSW 9 56259283 missense probably benign 0.01
R6284:Peak1 UTSW 9 56260296 missense probably benign 0.10
R6374:Peak1 UTSW 9 56257666 missense probably damaging 1.00
R6471:Peak1 UTSW 9 56258259 missense probably damaging 1.00
R6717:Peak1 UTSW 9 56207239 missense probably benign 0.00
R7033:Peak1 UTSW 9 56259707 missense probably damaging 1.00
R7039:Peak1 UTSW 9 56257809 missense probably benign 0.01
R7100:Peak1 UTSW 9 56259393 missense probably damaging 1.00
R7604:Peak1 UTSW 9 56241207 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAACAGGTTACTTGCATGG -3'
(R):5'- ACAGAGGTCAGTCTTCTCCAC -3'

Sequencing Primer
(F):5'- CAACAGGTTACTTGCATGGTAAGG -3'
(R):5'- ACAAGGGTCTCAGGTGCCAG -3'
Posted On2018-06-06