Incidental Mutation 'R6347:Lcp2'
ID520067
Institutional Source Beutler Lab
Gene Symbol Lcp2
Ensembl Gene ENSMUSG00000002699
Gene Namelymphocyte cytosolic protein 2
Synonymstwm, SLP76, SLP-76
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6347 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location34046920-34092295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34082501 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 360 (M360V)
Ref Sequence ENSEMBL: ENSMUSP00000104952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052413] [ENSMUST00000109329]
Predicted Effect probably benign
Transcript: ENSMUST00000052413
AA Change: M360V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000056621
Gene: ENSMUSG00000002699
AA Change: M360V

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.93e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 400 412 N/A INTRINSIC
SH2 421 512 4.44e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109329
AA Change: M360V

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104952
Gene: ENSMUSG00000002699
AA Change: M360V

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.86e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 400 412 N/A INTRINSIC
SH2 421 508 8.9e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146318
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that acts as a substrate of the T cell antigen receptor (TCR)-activated protein tyrosine kinase pathway. The encoded protein associates with growth factor receptor bound protein 2, and is thought to play a role TCR-mediated intracellular signal transduction. A similar protein in mouse plays a role in normal T-cell development and activation. Mice lacking this gene show subcutaneous and intraperitoneal fetal hemorrhaging, dysfunctional platelets and impaired viability. [provided by RefSeq, Nov 2016]
PHENOTYPE: T cell development is blocked and T cell receptor signaling impaired in homozygous point mutants. Double positive thymocyte and single positive T cell numbers are much reduced. Both positive and negative thymocyte selection is abnormal. Mice have high IgG and IgE levels and exhibit autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G T 2: 173,527,915 R74L possibly damaging Het
Atat1 A G 17: 35,910,029 F3L probably damaging Het
Atf7 T A 15: 102,546,479 M285L possibly damaging Het
Bcl7b T C 5: 135,180,533 S95P possibly damaging Het
Cald1 A C 6: 34,765,046 K453Q probably damaging Het
Cog4 A T 8: 110,880,643 I580F probably damaging Het
Cpq T A 15: 33,290,186 probably null Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
Dst A G 1: 34,179,684 probably null Het
Eif2b3 T C 4: 117,044,566 V142A probably benign Het
Fat3 A T 9: 15,998,372 N2111K probably damaging Het
Fbxo31 C A 8: 121,578,459 E99D possibly damaging Het
Fgfr2 T C 7: 130,261,757 E34G probably damaging Het
Flvcr2 T C 12: 85,747,420 V190A possibly damaging Het
Herc2 T C 7: 56,194,403 probably null Het
Igkv3-2 A C 6: 70,699,033 M109L probably benign Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kif13b C T 14: 64,767,619 T1120I probably benign Het
Kmt2c A G 5: 25,310,835 I2670T possibly damaging Het
Ldlrad4 A G 18: 68,235,780 S103G probably benign Het
Loxl4 T C 19: 42,608,270 K88E probably damaging Het
Ltbp2 C A 12: 84,853,912 R192L probably damaging Het
Mast2 C A 4: 116,317,732 G475V probably damaging Het
Meis1 A C 11: 18,905,631 probably null Het
Mroh3 T C 1: 136,200,937 probably null Het
Myo5b C T 18: 74,770,385 A1824V probably benign Het
Nectin3 C T 16: 46,458,124 V303M probably benign Het
Olfr472 T C 7: 107,902,950 S78P possibly damaging Het
Peak1 T C 9: 56,258,211 N811S probably benign Het
Pik3ca C T 3: 32,462,821 A1066V probably benign Het
Rnf103 A G 6: 71,505,824 T153A possibly damaging Het
Sacs G A 14: 61,211,160 V3552I probably damaging Het
Sgca A T 11: 94,972,028 N109K probably damaging Het
Speg T A 1: 75,426,875 M2621K probably benign Het
Stfa2l1 T C 16: 36,156,901 I22T probably damaging Het
Tbpl2 G A 2: 24,094,703 P144L probably benign Het
Tmem219 T C 7: 126,896,826 N119S possibly damaging Het
Ush2a A G 1: 188,910,887 T4149A probably benign Het
Wdr46 C A 17: 33,941,852 P197T probably damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Other mutations in Lcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Lcp2 APN 11 34047345 start gained probably benign
IGL01730:Lcp2 APN 11 34050943 missense possibly damaging 0.91
IGL02174:Lcp2 APN 11 34050966 splice site probably benign
IGL02228:Lcp2 APN 11 34047424 missense probably damaging 1.00
IGL02814:Lcp2 APN 11 34071033 missense probably damaging 1.00
R0142:Lcp2 UTSW 11 34082418 missense probably damaging 0.97
R0277:Lcp2 UTSW 11 34054322 missense probably damaging 1.00
R0281:Lcp2 UTSW 11 34069854 splice site probably benign
R0323:Lcp2 UTSW 11 34054322 missense probably damaging 1.00
R0437:Lcp2 UTSW 11 34087229 missense probably benign 0.00
R0632:Lcp2 UTSW 11 34082426 missense possibly damaging 0.87
R1479:Lcp2 UTSW 11 34075068 missense probably benign 0.01
R1570:Lcp2 UTSW 11 34089601 missense probably benign 0.07
R1744:Lcp2 UTSW 11 34069911 splice site probably null
R2212:Lcp2 UTSW 11 34070995 missense probably benign 0.14
R2910:Lcp2 UTSW 11 34068970 unclassified probably null
R2911:Lcp2 UTSW 11 34068970 unclassified probably null
R3196:Lcp2 UTSW 11 34090670 missense probably benign 0.05
R4012:Lcp2 UTSW 11 34068439 missense probably damaging 1.00
R4411:Lcp2 UTSW 11 34087173 unclassified probably benign
R4417:Lcp2 UTSW 11 34050917 missense probably benign 0.27
R4423:Lcp2 UTSW 11 34078226 intron probably benign
R4718:Lcp2 UTSW 11 34070992 missense probably benign 0.09
R5090:Lcp2 UTSW 11 34089725 nonsense probably null
R7315:Lcp2 UTSW 11 34069906 critical splice donor site probably null
R7694:Lcp2 UTSW 11 34050924 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTCATGTCAGCTGGGTTTGA -3'
(R):5'- CTGGTGTTTGCCGTAGCTAAGT -3'

Sequencing Primer
(F):5'- CATGTCAGCTGGGTTTGATTTAAG -3'
(R):5'- GAGTACACTGTGGCTAGCTAC -3'
Posted On2018-06-06