Incidental Mutation 'R6347:Cpq'
ID520073
Institutional Source Beutler Lab
Gene Symbol Cpq
Ensembl Gene ENSMUSG00000039007
Gene Namecarboxypeptidase Q
Synonyms2610034C17Rik, HLS2, Lal-1, Pgcp, 1190003P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.549) question?
Stock #R6347 (G1)
Quality Score99.0078
Status Validated
Chromosome15
Chromosomal Location33083129-33594552 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 33290186 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042167] [ENSMUST00000228916]
Predicted Effect probably null
Transcript: ENSMUST00000042167
SMART Domains Protein: ENSMUSP00000039046
Gene: ENSMUSG00000039007

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
Pfam:Peptidase_M28 268 457 5.9e-29 PFAM
Pfam:Peptidase_M20 284 457 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226896
Predicted Effect probably null
Transcript: ENSMUST00000228916
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallopeptidase that belongs to the peptidase M28 family. The encoded protein may catalyze the cleavage of dipeptides with unsubstituted terminals into amino acids. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G T 2: 173,527,915 R74L possibly damaging Het
Atat1 A G 17: 35,910,029 F3L probably damaging Het
Atf7 T A 15: 102,546,479 M285L possibly damaging Het
Bcl7b T C 5: 135,180,533 S95P possibly damaging Het
Cald1 A C 6: 34,765,046 K453Q probably damaging Het
Cog4 A T 8: 110,880,643 I580F probably damaging Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
Dst A G 1: 34,179,684 probably null Het
Eif2b3 T C 4: 117,044,566 V142A probably benign Het
Fat3 A T 9: 15,998,372 N2111K probably damaging Het
Fbxo31 C A 8: 121,578,459 E99D possibly damaging Het
Fgfr2 T C 7: 130,261,757 E34G probably damaging Het
Flvcr2 T C 12: 85,747,420 V190A possibly damaging Het
Herc2 T C 7: 56,194,403 probably null Het
Igkv3-2 A C 6: 70,699,033 M109L probably benign Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kif13b C T 14: 64,767,619 T1120I probably benign Het
Kmt2c A G 5: 25,310,835 I2670T possibly damaging Het
Lcp2 A G 11: 34,082,501 M360V probably benign Het
Ldlrad4 A G 18: 68,235,780 S103G probably benign Het
Loxl4 T C 19: 42,608,270 K88E probably damaging Het
Ltbp2 C A 12: 84,853,912 R192L probably damaging Het
Mast2 C A 4: 116,317,732 G475V probably damaging Het
Meis1 A C 11: 18,905,631 probably null Het
Mroh3 T C 1: 136,200,937 probably null Het
Myo5b C T 18: 74,770,385 A1824V probably benign Het
Nectin3 C T 16: 46,458,124 V303M probably benign Het
Olfr472 T C 7: 107,902,950 S78P possibly damaging Het
Peak1 T C 9: 56,258,211 N811S probably benign Het
Pik3ca C T 3: 32,462,821 A1066V probably benign Het
Rnf103 A G 6: 71,505,824 T153A possibly damaging Het
Sacs G A 14: 61,211,160 V3552I probably damaging Het
Sgca A T 11: 94,972,028 N109K probably damaging Het
Speg T A 1: 75,426,875 M2621K probably benign Het
Stfa2l1 T C 16: 36,156,901 I22T probably damaging Het
Tbpl2 G A 2: 24,094,703 P144L probably benign Het
Tmem219 T C 7: 126,896,826 N119S possibly damaging Het
Ush2a A G 1: 188,910,887 T4149A probably benign Het
Wdr46 C A 17: 33,941,852 P197T probably damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Other mutations in Cpq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Cpq APN 15 33497287 missense probably benign
IGL01773:Cpq APN 15 33212850 missense probably benign 0.42
IGL02406:Cpq APN 15 33302508 missense probably damaging 1.00
IGL02527:Cpq APN 15 33302363 missense probably damaging 1.00
IGL02596:Cpq APN 15 33213014 missense probably damaging 1.00
IGL02642:Cpq APN 15 33381400 missense probably damaging 0.99
IGL03382:Cpq APN 15 33212943 missense probably damaging 0.96
R0309:Cpq UTSW 15 33594151 missense probably damaging 1.00
R1545:Cpq UTSW 15 33250000 missense probably damaging 1.00
R1698:Cpq UTSW 15 33250126 missense probably benign 0.45
R1967:Cpq UTSW 15 33497202 missense possibly damaging 0.65
R2321:Cpq UTSW 15 33594145 missense probably benign
R2431:Cpq UTSW 15 33594119 nonsense probably null
R4705:Cpq UTSW 15 33497338 missense probably benign
R5087:Cpq UTSW 15 33212862 missense probably benign 0.08
R5367:Cpq UTSW 15 33213104 missense possibly damaging 0.91
R5790:Cpq UTSW 15 33249997 missense probably damaging 1.00
R7319:Cpq UTSW 15 33250039 missense probably benign 0.02
R7495:Cpq UTSW 15 33302440 missense probably damaging 0.98
R7711:Cpq UTSW 15 33497347 missense probably benign 0.04
R7806:Cpq UTSW 15 33497297 missense possibly damaging 0.83
X0063:Cpq UTSW 15 33213252 missense probably damaging 1.00
Z1176:Cpq UTSW 15 33381391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATATCAGGGTCCTGTCAGCAAAA -3'
(R):5'- GGAAACCAGTCTGGCAGTT -3'

Sequencing Primer
(F):5'- CAGGGTCCTGTCAGCAAAATCTTG -3'
(R):5'- CTGGCAGTTCCTCAGAATATTGGAC -3'
Posted On2018-06-06