Incidental Mutation 'R6347:Atf7'
ID520075
Institutional Source Beutler Lab
Gene Symbol Atf7
Ensembl Gene ENSMUSG00000099083
Gene Nameactivating transcription factor 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6347 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102525946-102625464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102546479 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 285 (M285L)
Ref Sequence ENSEMBL: ENSMUSP00000139243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108828] [ENSMUST00000169033] [ENSMUST00000183452] [ENSMUST00000183765] [ENSMUST00000184077] [ENSMUST00000184485] [ENSMUST00000184616] [ENSMUST00000184772] [ENSMUST00000184906] [ENSMUST00000185070]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108828
AA Change: M285L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104456
Gene: ENSMUSG00000099083
AA Change: M285L

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169033
AA Change: M285L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130130
Gene: ENSMUSG00000099083
AA Change: M285L

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183452
SMART Domains Protein: ENSMUSP00000139367
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183727
Predicted Effect probably benign
Transcript: ENSMUST00000183765
SMART Domains Protein: ENSMUSP00000139054
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184077
SMART Domains Protein: ENSMUSP00000139217
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000184485
AA Change: M285L

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139308
Gene: ENSMUSG00000099083
AA Change: M285L

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184616
AA Change: M285L

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139181
Gene: ENSMUSG00000099083
AA Change: M285L

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184772
AA Change: M285L

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138975
Gene: ENSMUSG00000052414
AA Change: M285L

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184906
AA Change: M285L

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139243
Gene: ENSMUSG00000099083
AA Change: M285L

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185070
SMART Domains Protein: ENSMUSP00000139379
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele exhibit increased marble burying, increased startle response, and decreased prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G T 2: 173,527,915 R74L possibly damaging Het
Atat1 A G 17: 35,910,029 F3L probably damaging Het
Bcl7b T C 5: 135,180,533 S95P possibly damaging Het
Cald1 A C 6: 34,765,046 K453Q probably damaging Het
Cog4 A T 8: 110,880,643 I580F probably damaging Het
Cpq T A 15: 33,290,186 probably null Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
Dst A G 1: 34,179,684 probably null Het
Eif2b3 T C 4: 117,044,566 V142A probably benign Het
Fat3 A T 9: 15,998,372 N2111K probably damaging Het
Fbxo31 C A 8: 121,578,459 E99D possibly damaging Het
Fgfr2 T C 7: 130,261,757 E34G probably damaging Het
Flvcr2 T C 12: 85,747,420 V190A possibly damaging Het
Herc2 T C 7: 56,194,403 probably null Het
Igkv3-2 A C 6: 70,699,033 M109L probably benign Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kif13b C T 14: 64,767,619 T1120I probably benign Het
Kmt2c A G 5: 25,310,835 I2670T possibly damaging Het
Lcp2 A G 11: 34,082,501 M360V probably benign Het
Ldlrad4 A G 18: 68,235,780 S103G probably benign Het
Loxl4 T C 19: 42,608,270 K88E probably damaging Het
Ltbp2 C A 12: 84,853,912 R192L probably damaging Het
Mast2 C A 4: 116,317,732 G475V probably damaging Het
Meis1 A C 11: 18,905,631 probably null Het
Mroh3 T C 1: 136,200,937 probably null Het
Myo5b C T 18: 74,770,385 A1824V probably benign Het
Nectin3 C T 16: 46,458,124 V303M probably benign Het
Olfr472 T C 7: 107,902,950 S78P possibly damaging Het
Peak1 T C 9: 56,258,211 N811S probably benign Het
Pik3ca C T 3: 32,462,821 A1066V probably benign Het
Rnf103 A G 6: 71,505,824 T153A possibly damaging Het
Sacs G A 14: 61,211,160 V3552I probably damaging Het
Sgca A T 11: 94,972,028 N109K probably damaging Het
Speg T A 1: 75,426,875 M2621K probably benign Het
Stfa2l1 T C 16: 36,156,901 I22T probably damaging Het
Tbpl2 G A 2: 24,094,703 P144L probably benign Het
Tmem219 T C 7: 126,896,826 N119S possibly damaging Het
Ush2a A G 1: 188,910,887 T4149A probably benign Het
Wdr46 C A 17: 33,941,852 P197T probably damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Other mutations in Atf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01914:Atf7 APN 15 102551478 nonsense probably null
R2183:Atf7 UTSW 15 102546473 missense possibly damaging 0.93
R2516:Atf7 UTSW 15 102529004 intron probably benign
R3114:Atf7 UTSW 15 102534423 missense probably benign 0.10
R3115:Atf7 UTSW 15 102534423 missense probably benign 0.10
R4544:Atf7 UTSW 15 102534327 missense probably benign 0.08
R4545:Atf7 UTSW 15 102534327 missense probably benign 0.08
R4546:Atf7 UTSW 15 102534327 missense probably benign 0.08
R5148:Atf7 UTSW 15 102547173 missense probably benign 0.02
R5568:Atf7 UTSW 15 102563322 missense probably damaging 0.99
R5688:Atf7 UTSW 15 102551509 missense probably damaging 1.00
R5805:Atf7 UTSW 15 102557587 splice site probably null
R6021:Atf7 UTSW 15 102557473 missense probably benign 0.20
R6259:Atf7 UTSW 15 102547238 missense probably damaging 1.00
R6476:Atf7 UTSW 15 102593712 missense probably benign 0.13
R6794:Atf7 UTSW 15 102557465 missense probably benign 0.09
R7104:Atf7 UTSW 15 102534235 missense probably benign 0.40
R7369:Atf7 UTSW 15 102553809 missense probably damaging 0.98
R8111:Atf7 UTSW 15 102563334 missense probably damaging 0.96
R8244:Atf7 UTSW 15 102528866 missense unknown
X0027:Atf7 UTSW 15 102593670 critical splice donor site probably null
Z1088:Atf7 UTSW 15 102547182 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAGCTGGTTACCCCAAAAGC -3'
(R):5'- ATCCAGGTGGGCACTTTTC -3'

Sequencing Primer
(F):5'- GGTTACCCCAAAAGCTAAATTTATTC -3'
(R):5'- GTTCCCTGTTAAGAAAAACTTGGGGC -3'
Posted On2018-06-06