Incidental Mutation 'R6347:Nectin3'
ID 520077
Institutional Source Beutler Lab
Gene Symbol Nectin3
Ensembl Gene ENSMUSG00000022656
Gene Name nectin cell adhesion molecule 3
Synonyms 2610301B19Rik, nectin-3, 3000002N23Rik, Pvrl3, 4921513D19Rik
MMRRC Submission 044501-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.269) question?
Stock # R6347 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 46208069-46318888 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 46278487 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 303 (V303M)
Ref Sequence ENSEMBL: ENSMUSP00000093757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023334] [ENSMUST00000023335] [ENSMUST00000096052]
AlphaFold Q9JLB9
Predicted Effect probably benign
Transcript: ENSMUST00000023334
AA Change: V303M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000023334
Gene: ENSMUSG00000022656
AA Change: V303M

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 1.5e-19 PFAM
Pfam:Ig_3 284 342 3.1e-6 PFAM
low complexity region 358 367 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023335
AA Change: V303M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000023335
Gene: ENSMUSG00000022656
AA Change: V303M

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2.5e-19 PFAM
Pfam:Ig_2 281 355 1.3e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096052
AA Change: V303M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000093757
Gene: ENSMUSG00000022656
AA Change: V303M

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2e-19 PFAM
Pfam:Ig_2 281 355 1e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133935
Predicted Effect unknown
Transcript: ENSMUST00000149901
AA Change: V203M
SMART Domains Protein: ENSMUSP00000117479
Gene: ENSMUSG00000022656
AA Change: V203M

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:Ig_3 184 243 4.8e-5 PFAM
Meta Mutation Damage Score 0.0827 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit male infertility and eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atat1 A G 17: 36,220,921 (GRCm39) F3L probably damaging Het
Atf7 T A 15: 102,454,914 (GRCm39) M285L possibly damaging Het
Bcl7b T C 5: 135,209,387 (GRCm39) S95P possibly damaging Het
Cald1 A C 6: 34,741,981 (GRCm39) K453Q probably damaging Het
Cimip1 G T 2: 173,369,708 (GRCm39) R74L possibly damaging Het
Cog4 A T 8: 111,607,275 (GRCm39) I580F probably damaging Het
Cpq T A 15: 33,290,332 (GRCm39) probably null Het
Csf2rb G A 15: 78,229,752 (GRCm39) D440N probably damaging Het
Dst A G 1: 34,218,765 (GRCm39) probably null Het
Eif2b3 T C 4: 116,901,763 (GRCm39) V142A probably benign Het
Fat3 A T 9: 15,909,668 (GRCm39) N2111K probably damaging Het
Fbxo31 C A 8: 122,305,198 (GRCm39) E99D possibly damaging Het
Fgfr2 T C 7: 129,863,487 (GRCm39) E34G probably damaging Het
Flvcr2 T C 12: 85,794,194 (GRCm39) V190A possibly damaging Het
Herc2 T C 7: 55,844,151 (GRCm39) probably null Het
Igkv3-2 A C 6: 70,676,017 (GRCm39) M109L probably benign Het
Il36rn G A 2: 24,169,726 (GRCm39) A29T probably damaging Het
Kif13b C T 14: 65,005,068 (GRCm39) T1120I probably benign Het
Kmt2c A G 5: 25,515,833 (GRCm39) I2670T possibly damaging Het
Lcp2 A G 11: 34,032,501 (GRCm39) M360V probably benign Het
Ldlrad4 A G 18: 68,368,851 (GRCm39) S103G probably benign Het
Loxl4 T C 19: 42,596,709 (GRCm39) K88E probably damaging Het
Ltbp2 C A 12: 84,900,686 (GRCm39) R192L probably damaging Het
Mast2 C A 4: 116,174,929 (GRCm39) G475V probably damaging Het
Meis1 A C 11: 18,855,631 (GRCm39) probably null Het
Mroh3 T C 1: 136,128,675 (GRCm39) probably null Het
Myo5b C T 18: 74,903,456 (GRCm39) A1824V probably benign Het
Or5p52 T C 7: 107,502,157 (GRCm39) S78P possibly damaging Het
Peak1 T C 9: 56,165,495 (GRCm39) N811S probably benign Het
Pik3ca C T 3: 32,516,970 (GRCm39) A1066V probably benign Het
Rnf103 A G 6: 71,482,808 (GRCm39) T153A possibly damaging Het
Sacs G A 14: 61,448,609 (GRCm39) V3552I probably damaging Het
Sgca A T 11: 94,862,854 (GRCm39) N109K probably damaging Het
Speg T A 1: 75,403,519 (GRCm39) M2621K probably benign Het
Stfa2l1 T C 16: 35,977,271 (GRCm39) I22T probably damaging Het
Tbpl2 G A 2: 23,984,715 (GRCm39) P144L probably benign Het
Tmem219 T C 7: 126,495,998 (GRCm39) N119S possibly damaging Het
Ush2a A G 1: 188,643,084 (GRCm39) T4149A probably benign Het
Wdr46 C A 17: 34,160,826 (GRCm39) P197T probably damaging Het
Wee2 C T 6: 40,432,039 (GRCm39) R203C probably damaging Het
Other mutations in Nectin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Nectin3 APN 16 46,279,216 (GRCm39) missense probably benign 0.23
R0373:Nectin3 UTSW 16 46,278,550 (GRCm39) missense probably damaging 0.99
R0550:Nectin3 UTSW 16 46,279,183 (GRCm39) missense possibly damaging 0.86
R1219:Nectin3 UTSW 16 46,275,042 (GRCm39) nonsense probably null
R1251:Nectin3 UTSW 16 46,284,205 (GRCm39) missense possibly damaging 0.82
R1398:Nectin3 UTSW 16 46,269,119 (GRCm39) missense possibly damaging 0.95
R1439:Nectin3 UTSW 16 46,268,757 (GRCm39) nonsense probably null
R2250:Nectin3 UTSW 16 46,275,099 (GRCm39) missense probably benign 0.00
R2448:Nectin3 UTSW 16 46,268,878 (GRCm39) splice site probably null
R2483:Nectin3 UTSW 16 46,215,542 (GRCm39) missense possibly damaging 0.83
R4523:Nectin3 UTSW 16 46,268,953 (GRCm39) missense probably benign 0.15
R4709:Nectin3 UTSW 16 46,284,306 (GRCm39) missense possibly damaging 0.58
R4809:Nectin3 UTSW 16 46,268,523 (GRCm39) intron probably benign
R4884:Nectin3 UTSW 16 46,269,249 (GRCm39) missense probably benign 0.01
R5051:Nectin3 UTSW 16 46,268,913 (GRCm39) missense possibly damaging 0.95
R5061:Nectin3 UTSW 16 46,268,812 (GRCm39) missense probably benign 0.03
R5272:Nectin3 UTSW 16 46,268,839 (GRCm39) missense possibly damaging 0.82
R5365:Nectin3 UTSW 16 46,284,469 (GRCm39) nonsense probably null
R5768:Nectin3 UTSW 16 46,279,180 (GRCm39) missense probably damaging 0.98
R5987:Nectin3 UTSW 16 46,284,508 (GRCm39) missense probably benign 0.00
R6029:Nectin3 UTSW 16 46,256,763 (GRCm39) missense probably benign 0.08
R6131:Nectin3 UTSW 16 46,215,515 (GRCm39) missense probably damaging 0.98
R6251:Nectin3 UTSW 16 46,215,513 (GRCm39) missense probably damaging 0.99
R6299:Nectin3 UTSW 16 46,284,345 (GRCm39) missense probably damaging 0.98
R6360:Nectin3 UTSW 16 46,231,472 (GRCm39) missense probably benign 0.09
R6505:Nectin3 UTSW 16 46,269,184 (GRCm39) missense possibly damaging 0.68
R6703:Nectin3 UTSW 16 46,284,205 (GRCm39) missense probably damaging 0.99
R6869:Nectin3 UTSW 16 46,215,506 (GRCm39) missense probably damaging 0.96
R7184:Nectin3 UTSW 16 46,215,484 (GRCm39) missense possibly damaging 0.66
R7298:Nectin3 UTSW 16 46,268,759 (GRCm39) missense probably damaging 1.00
R7455:Nectin3 UTSW 16 46,317,105 (GRCm39) nonsense probably null
R7973:Nectin3 UTSW 16 46,216,484 (GRCm39) missense probably benign 0.13
R7993:Nectin3 UTSW 16 46,279,184 (GRCm39) missense probably benign 0.01
R8108:Nectin3 UTSW 16 46,284,484 (GRCm39) missense possibly damaging 0.84
R8259:Nectin3 UTSW 16 46,256,754 (GRCm39) missense probably benign 0.00
R8511:Nectin3 UTSW 16 46,284,363 (GRCm39) missense probably damaging 1.00
R8971:Nectin3 UTSW 16 46,269,265 (GRCm39) missense probably benign
R9195:Nectin3 UTSW 16 46,279,259 (GRCm39) nonsense probably null
R9264:Nectin3 UTSW 16 46,274,998 (GRCm39) missense probably damaging 1.00
R9492:Nectin3 UTSW 16 46,215,511 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTCTAACACTGCTGCCAG -3'
(R):5'- GCCTTCCCGAGTGATTATGC -3'

Sequencing Primer
(F):5'- CCAGGACAGGATGGTAAGAGAC -3'
(R):5'- CCTTCCCGAGTGATTATGCTGAAAG -3'
Posted On 2018-06-06