Incidental Mutation 'R6347:Wdr46'
ID520078
Institutional Source Beutler Lab
Gene Symbol Wdr46
Ensembl Gene ENSMUSG00000024312
Gene NameWD repeat domain 46
SynonymsBing4, 2310007I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R6347 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33940660-33949695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 33941852 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 197 (P197T)
Ref Sequence ENSEMBL: ENSMUSP00000025170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000174426] [ENSMUST00000179418]
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025170
AA Change: P197T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312
AA Change: P197T

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172546
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173857
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G T 2: 173,527,915 R74L possibly damaging Het
Atat1 A G 17: 35,910,029 F3L probably damaging Het
Atf7 T A 15: 102,546,479 M285L possibly damaging Het
Bcl7b T C 5: 135,180,533 S95P possibly damaging Het
Cald1 A C 6: 34,765,046 K453Q probably damaging Het
Cog4 A T 8: 110,880,643 I580F probably damaging Het
Cpq T A 15: 33,290,186 probably null Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
Dst A G 1: 34,179,684 probably null Het
Eif2b3 T C 4: 117,044,566 V142A probably benign Het
Fat3 A T 9: 15,998,372 N2111K probably damaging Het
Fbxo31 C A 8: 121,578,459 E99D possibly damaging Het
Fgfr2 T C 7: 130,261,757 E34G probably damaging Het
Flvcr2 T C 12: 85,747,420 V190A possibly damaging Het
Herc2 T C 7: 56,194,403 probably null Het
Igkv3-2 A C 6: 70,699,033 M109L probably benign Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kif13b C T 14: 64,767,619 T1120I probably benign Het
Kmt2c A G 5: 25,310,835 I2670T possibly damaging Het
Lcp2 A G 11: 34,082,501 M360V probably benign Het
Ldlrad4 A G 18: 68,235,780 S103G probably benign Het
Loxl4 T C 19: 42,608,270 K88E probably damaging Het
Ltbp2 C A 12: 84,853,912 R192L probably damaging Het
Mast2 C A 4: 116,317,732 G475V probably damaging Het
Meis1 A C 11: 18,905,631 probably null Het
Mroh3 T C 1: 136,200,937 probably null Het
Myo5b C T 18: 74,770,385 A1824V probably benign Het
Nectin3 C T 16: 46,458,124 V303M probably benign Het
Olfr472 T C 7: 107,902,950 S78P possibly damaging Het
Peak1 T C 9: 56,258,211 N811S probably benign Het
Pik3ca C T 3: 32,462,821 A1066V probably benign Het
Rnf103 A G 6: 71,505,824 T153A possibly damaging Het
Sacs G A 14: 61,211,160 V3552I probably damaging Het
Sgca A T 11: 94,972,028 N109K probably damaging Het
Speg T A 1: 75,426,875 M2621K probably benign Het
Stfa2l1 T C 16: 36,156,901 I22T probably damaging Het
Tbpl2 G A 2: 24,094,703 P144L probably benign Het
Tmem219 T C 7: 126,896,826 N119S possibly damaging Het
Ush2a A G 1: 188,910,887 T4149A probably benign Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Other mutations in Wdr46
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0147:Wdr46 UTSW 17 33941023 missense probably benign
R0148:Wdr46 UTSW 17 33941023 missense probably benign
R1405:Wdr46 UTSW 17 33949083 missense probably damaging 1.00
R1405:Wdr46 UTSW 17 33949083 missense probably damaging 1.00
R2085:Wdr46 UTSW 17 33941451 nonsense probably null
R4319:Wdr46 UTSW 17 33940744 missense probably benign 0.04
R4368:Wdr46 UTSW 17 33941146 unclassified probably benign
R4831:Wdr46 UTSW 17 33941836 missense probably benign 0.17
R4831:Wdr46 UTSW 17 33949399 unclassified probably benign
R5118:Wdr46 UTSW 17 33948837 missense possibly damaging 0.65
R6211:Wdr46 UTSW 17 33944485 missense probably damaging 1.00
R6529:Wdr46 UTSW 17 33949146 missense possibly damaging 0.78
R7318:Wdr46 UTSW 17 33941885 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGACAGACATCGTGGAG -3'
(R):5'- AGGCTATAACCCTAGCACGC -3'

Sequencing Primer
(F):5'- CAGACATCGTGGAGGCTGTG -3'
(R):5'- CAGGGTGACGACGGCAG -3'
Posted On2018-06-06