Incidental Mutation 'R6453:Flt1'
ID520103
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene NameFMS-like tyrosine kinase 1
SynonymsFlt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6453 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location147561604-147726011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 147683941 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 131 (D131G)
Ref Sequence ENSEMBL: ENSMUSP00000031653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653] [ENSMUST00000110529]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031652
SMART Domains Protein: ENSMUSP00000031652
Gene: ENSMUSG00000029648

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
Pfam:Ig_2 434 511 9.6e-3 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000031653
AA Change: D131G

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: D131G

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110529
AA Change: D131G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106158
Gene: ENSMUSG00000029648
AA Change: D131G

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik A G 2: 173,528,259 Y109C probably benign Het
2300002M23Rik C T 17: 35,568,212 S149L possibly damaging Het
A830018L16Rik A T 1: 11,798,558 D354V possibly damaging Het
Acta2 G A 19: 34,246,657 T150I probably damaging Het
Adgra1 T A 7: 139,875,427 S324T probably benign Het
Ankrd44 A T 1: 54,657,704 probably null Het
B430306N03Rik T A 17: 48,316,736 W22R probably damaging Het
C130060K24Rik G A 6: 65,453,030 G237S possibly damaging Het
Ccdc162 A T 10: 41,550,825 V2024E probably damaging Het
Cers6 C T 2: 69,047,169 H164Y probably benign Het
Chd3 T A 11: 69,350,112 K1458* probably null Het
Col3a1 G A 1: 45,339,378 probably benign Het
Cyb5d2 T G 11: 72,782,760 T3P probably benign Het
Dennd1b A G 1: 139,143,948 Y468C probably benign Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Exoc7 T C 11: 116,293,969 probably null Het
Fat2 A G 11: 55,282,216 I2557T probably benign Het
Frem1 G T 4: 82,914,825 S1858* probably null Het
Garem1 T A 18: 21,148,739 I187F probably damaging Het
Gldc A T 19: 30,116,517 I700N probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpatch4 A G 3: 88,055,005 E175G probably damaging Het
Gria2 A G 3: 80,740,974 Y152H possibly damaging Het
H2-Q2 C T 17: 35,344,895 L251F probably benign Het
Hectd4 G A 5: 121,350,592 G3649R probably damaging Het
Hormad1 A G 3: 95,578,257 E252G probably benign Het
Kif14 A G 1: 136,482,304 probably null Het
Lmcd1 A G 6: 112,315,828 T214A probably benign Het
Macrod2 A G 2: 142,176,625 E226G probably damaging Het
Mcm4 A T 16: 15,630,409 L428Q probably damaging Het
Msh6 T A 17: 87,985,739 Y641N probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Nipa2 A T 7: 55,935,821 M142K probably damaging Het
Olfr905 T C 9: 38,473,575 I276T probably benign Het
Parvg A T 15: 84,328,925 E122V probably null Het
Pclo T A 5: 14,676,789 probably benign Het
Pik3cd A G 4: 149,652,302 V933A probably damaging Het
Qpctl C T 7: 19,141,297 V337I probably damaging Het
Ralgapa1 A G 12: 55,738,319 W719R probably damaging Het
Rangrf A G 11: 68,973,552 L28P probably damaging Het
Rbbp9 G T 2: 144,549,134 Q38K probably benign Het
Rnf169 C T 7: 99,935,227 M246I probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Sdk1 A G 5: 142,096,921 D1098G probably damaging Het
Sgsm3 T A 15: 81,011,314 S689T probably damaging Het
Slc13a3 C T 2: 165,411,947 V429M possibly damaging Het
Slc30a5 A T 13: 100,814,689 D228E probably benign Het
Slc46a3 A G 5: 147,886,390 I214T possibly damaging Het
Slc7a15 T C 12: 8,534,490 M347V possibly damaging Het
Slc9a2 A T 1: 40,742,621 I337F possibly damaging Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Speg A G 1: 75,417,972 N1775S probably benign Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Sptbn2 A T 19: 4,744,180 R1471W possibly damaging Het
Thada T C 17: 84,416,323 E1101G probably damaging Het
Trpm6 G A 19: 18,829,990 A1033T probably damaging Het
Ttll6 G A 11: 96,158,727 R757H probably benign Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
BB008:Flt1 UTSW 5 147588572 missense probably damaging 1.00
BB018:Flt1 UTSW 5 147588572 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7195:Flt1 UTSW 5 147603576 missense probably damaging 1.00
R7255:Flt1 UTSW 5 147580406 missense probably damaging 1.00
R7347:Flt1 UTSW 5 147580381 missense probably damaging 1.00
R7469:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7473:Flt1 UTSW 5 147594595 missense probably damaging 1.00
R7663:Flt1 UTSW 5 147655120 missense probably benign
R7688:Flt1 UTSW 5 147676325 missense probably benign
R7729:Flt1 UTSW 5 147700367 missense probably benign 0.00
R7931:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R8051:Flt1 UTSW 5 147582691 missense probably benign 0.02
R8275:Flt1 UTSW 5 147678147 missense probably damaging 0.99
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACGAGTCTACTGAGAAGCCC -3'
(R):5'- AGAAACTACACTGCTTTGGGG -3'

Sequencing Primer
(F):5'- GCCCAGAGAGAAAGTTTTTCC -3'
(R):5'- ACTACACTGCTTTGGGGGACAG -3'
Posted On2018-06-06