Incidental Mutation 'R6453:Nipa2'
ID520109
Institutional Source Beutler Lab
Gene Symbol Nipa2
Ensembl Gene ENSMUSG00000030452
Gene Namenon imprinted in Prader-Willi/Angelman syndrome 2 homolog (human)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R6453 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location55931287-55962476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55935821 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 142 (M142K)
Ref Sequence ENSEMBL: ENSMUSP00000114020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032629] [ENSMUST00000032635] [ENSMUST00000117812] [ENSMUST00000119041] [ENSMUST00000119201] [ENSMUST00000126604] [ENSMUST00000152649]
Predicted Effect probably benign
Transcript: ENSMUST00000032629
SMART Domains Protein: ENSMUSP00000032629
Gene: ENSMUSG00000030447

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 302 5.7e-11 PFAM
Pfam:FragX_IP 389 1222 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000032635
AA Change: M142K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032635
Gene: ENSMUSG00000030452
AA Change: M142K

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117812
AA Change: M142K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113727
Gene: ENSMUSG00000030452
AA Change: M142K

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 8 302 1.4e-151 PFAM
Pfam:EamA 47 128 4.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119041
AA Change: M142K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112394
Gene: ENSMUSG00000030452
AA Change: M142K

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119201
AA Change: M142K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114020
Gene: ENSMUSG00000030452
AA Change: M142K

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126604
SMART Domains Protein: ENSMUSP00000116219
Gene: ENSMUSG00000030452

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 130 1.2e-66 PFAM
Pfam:EmrE 14 130 1.8e-11 PFAM
Pfam:EamA 50 128 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147950
Predicted Effect possibly damaging
Transcript: ENSMUST00000152649
AA Change: M123K

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120798
Gene: ENSMUSG00000030452
AA Change: M123K

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 127 1.9e-53 PFAM
Pfam:EamA 10 109 1.8e-9 PFAM
Pfam:EmrE 18 116 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a possible magnesium transporter. This gene is located adjacent to the imprinted domain in the Prader-Willi syndrome deletion region of chromosome 15. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 7 and 21.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik A G 2: 173,528,259 Y109C probably benign Het
2300002M23Rik C T 17: 35,568,212 S149L possibly damaging Het
A830018L16Rik A T 1: 11,798,558 D354V possibly damaging Het
Acta2 G A 19: 34,246,657 T150I probably damaging Het
Adgra1 T A 7: 139,875,427 S324T probably benign Het
Ankrd44 A T 1: 54,657,704 probably null Het
B430306N03Rik T A 17: 48,316,736 W22R probably damaging Het
C130060K24Rik G A 6: 65,453,030 G237S possibly damaging Het
Ccdc162 A T 10: 41,550,825 V2024E probably damaging Het
Cers6 C T 2: 69,047,169 H164Y probably benign Het
Chd3 T A 11: 69,350,112 K1458* probably null Het
Col3a1 G A 1: 45,339,378 probably benign Het
Cyb5d2 T G 11: 72,782,760 T3P probably benign Het
Dennd1b A G 1: 139,143,948 Y468C probably benign Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Exoc7 T C 11: 116,293,969 probably null Het
Fat2 A G 11: 55,282,216 I2557T probably benign Het
Flt1 T C 5: 147,683,941 D131G possibly damaging Het
Frem1 G T 4: 82,914,825 S1858* probably null Het
Garem1 T A 18: 21,148,739 I187F probably damaging Het
Gldc A T 19: 30,116,517 I700N probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpatch4 A G 3: 88,055,005 E175G probably damaging Het
Gria2 A G 3: 80,740,974 Y152H possibly damaging Het
H2-Q2 C T 17: 35,344,895 L251F probably benign Het
Hectd4 G A 5: 121,350,592 G3649R probably damaging Het
Hormad1 A G 3: 95,578,257 E252G probably benign Het
Kif14 A G 1: 136,482,304 probably null Het
Lmcd1 A G 6: 112,315,828 T214A probably benign Het
Macrod2 A G 2: 142,176,625 E226G probably damaging Het
Mcm4 A T 16: 15,630,409 L428Q probably damaging Het
Msh6 T A 17: 87,985,739 Y641N probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Olfr905 T C 9: 38,473,575 I276T probably benign Het
Parvg A T 15: 84,328,925 E122V probably null Het
Pclo T A 5: 14,676,789 probably benign Het
Pik3cd A G 4: 149,652,302 V933A probably damaging Het
Qpctl C T 7: 19,141,297 V337I probably damaging Het
Ralgapa1 A G 12: 55,738,319 W719R probably damaging Het
Rangrf A G 11: 68,973,552 L28P probably damaging Het
Rbbp9 G T 2: 144,549,134 Q38K probably benign Het
Rnf169 C T 7: 99,935,227 M246I probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Sdk1 A G 5: 142,096,921 D1098G probably damaging Het
Sgsm3 T A 15: 81,011,314 S689T probably damaging Het
Slc13a3 C T 2: 165,411,947 V429M possibly damaging Het
Slc30a5 A T 13: 100,814,689 D228E probably benign Het
Slc46a3 A G 5: 147,886,390 I214T possibly damaging Het
Slc7a15 T C 12: 8,534,490 M347V possibly damaging Het
Slc9a2 A T 1: 40,742,621 I337F possibly damaging Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Speg A G 1: 75,417,972 N1775S probably benign Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Sptbn2 A T 19: 4,744,180 R1471W possibly damaging Het
Thada T C 17: 84,416,323 E1101G probably damaging Het
Trpm6 G A 19: 18,829,990 A1033T probably damaging Het
Ttll6 G A 11: 96,158,727 R757H probably benign Het
Other mutations in Nipa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Nipa2 APN 7 55933445 missense probably damaging 1.00
IGL01965:Nipa2 APN 7 55944623 start gained probably benign
IGL02373:Nipa2 APN 7 55933128 missense probably benign 0.01
IGL02812:Nipa2 APN 7 55943018 missense probably damaging 1.00
IGL03079:Nipa2 APN 7 55933457 missense probably damaging 1.00
IGL03188:Nipa2 APN 7 55932932 missense probably benign
R1327:Nipa2 UTSW 7 55944508 missense possibly damaging 0.81
R2356:Nipa2 UTSW 7 55932966 missense probably benign 0.00
R3758:Nipa2 UTSW 7 55935941 missense probably damaging 1.00
R3870:Nipa2 UTSW 7 55932942 missense probably damaging 1.00
R4684:Nipa2 UTSW 7 55935826 missense probably benign
R4775:Nipa2 UTSW 7 55935863 missense probably benign 0.19
R5285:Nipa2 UTSW 7 55933012 nonsense probably null
R6880:Nipa2 UTSW 7 55933251 missense probably damaging 0.99
R7459:Nipa2 UTSW 7 55933341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGGATAATGACTTTGGCTAAGG -3'
(R):5'- CAGTGATCTGCATTGCAAGTC -3'

Sequencing Primer
(F):5'- AATGACTTTGGCTAAGGAAATAGC -3'
(R):5'- CTGCATTGCAAGTCTGTTAATTTTC -3'
Posted On2018-06-06