Incidental Mutation 'R6453:Rangrf'
ID520119
Institutional Source Beutler Lab
Gene Symbol Rangrf
Ensembl Gene ENSMUSG00000032892
Gene NameRAN guanine nucleotide release factor
SynonymsRangnrf, Mog1, 2400006H24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R6453 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location68972484-68975185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68973552 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 28 (L28P)
Ref Sequence ENSEMBL: ENSMUSP00000038485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018884] [ENSMUST00000038644] [ENSMUST00000102606]
Predicted Effect probably benign
Transcript: ENSMUST00000018884
SMART Domains Protein: ENSMUSP00000018884
Gene: ENSMUSG00000018740

DomainStartEndE-ValueType
Pfam:Mito_carr 1 90 4.5e-20 PFAM
Pfam:Mito_carr 98 193 2.2e-16 PFAM
Pfam:Mito_carr 197 295 6.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038644
AA Change: L28P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038485
Gene: ENSMUSG00000032892
AA Change: L28P

DomainStartEndE-ValueType
Pfam:Mog1 7 145 1.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102606
SMART Domains Protein: ENSMUSP00000099666
Gene: ENSMUSG00000018740

DomainStartEndE-ValueType
Pfam:Mito_carr 1 92 7.9e-17 PFAM
Pfam:Mito_carr 98 197 1.2e-16 PFAM
Pfam:Mito_carr 202 299 8.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156178
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been shown to function as a guanine nucleotide release factor in mouse and to regulate the expression and function of the Nav1.5 cardiac sodium channel in human. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik A G 2: 173,528,259 Y109C probably benign Het
2300002M23Rik C T 17: 35,568,212 S149L possibly damaging Het
A830018L16Rik A T 1: 11,798,558 D354V possibly damaging Het
Acta2 G A 19: 34,246,657 T150I probably damaging Het
Adgra1 T A 7: 139,875,427 S324T probably benign Het
Ankrd44 A T 1: 54,657,704 probably null Het
B430306N03Rik T A 17: 48,316,736 W22R probably damaging Het
C130060K24Rik G A 6: 65,453,030 G237S possibly damaging Het
Ccdc162 A T 10: 41,550,825 V2024E probably damaging Het
Cers6 C T 2: 69,047,169 H164Y probably benign Het
Chd3 T A 11: 69,350,112 K1458* probably null Het
Col3a1 G A 1: 45,339,378 probably benign Het
Cyb5d2 T G 11: 72,782,760 T3P probably benign Het
Dennd1b A G 1: 139,143,948 Y468C probably benign Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Exoc7 T C 11: 116,293,969 probably null Het
Fat2 A G 11: 55,282,216 I2557T probably benign Het
Flt1 T C 5: 147,683,941 D131G possibly damaging Het
Frem1 G T 4: 82,914,825 S1858* probably null Het
Garem1 T A 18: 21,148,739 I187F probably damaging Het
Gldc A T 19: 30,116,517 I700N probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpatch4 A G 3: 88,055,005 E175G probably damaging Het
Gria2 A G 3: 80,740,974 Y152H possibly damaging Het
H2-Q2 C T 17: 35,344,895 L251F probably benign Het
Hectd4 G A 5: 121,350,592 G3649R probably damaging Het
Hormad1 A G 3: 95,578,257 E252G probably benign Het
Kif14 A G 1: 136,482,304 probably null Het
Lmcd1 A G 6: 112,315,828 T214A probably benign Het
Macrod2 A G 2: 142,176,625 E226G probably damaging Het
Mcm4 A T 16: 15,630,409 L428Q probably damaging Het
Msh6 T A 17: 87,985,739 Y641N probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Nipa2 A T 7: 55,935,821 M142K probably damaging Het
Olfr905 T C 9: 38,473,575 I276T probably benign Het
Parvg A T 15: 84,328,925 E122V probably null Het
Pclo T A 5: 14,676,789 probably benign Het
Pik3cd A G 4: 149,652,302 V933A probably damaging Het
Qpctl C T 7: 19,141,297 V337I probably damaging Het
Ralgapa1 A G 12: 55,738,319 W719R probably damaging Het
Rbbp9 G T 2: 144,549,134 Q38K probably benign Het
Rnf169 C T 7: 99,935,227 M246I probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Sdk1 A G 5: 142,096,921 D1098G probably damaging Het
Sgsm3 T A 15: 81,011,314 S689T probably damaging Het
Slc13a3 C T 2: 165,411,947 V429M possibly damaging Het
Slc30a5 A T 13: 100,814,689 D228E probably benign Het
Slc46a3 A G 5: 147,886,390 I214T possibly damaging Het
Slc7a15 T C 12: 8,534,490 M347V possibly damaging Het
Slc9a2 A T 1: 40,742,621 I337F possibly damaging Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Speg A G 1: 75,417,972 N1775S probably benign Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Sptbn2 A T 19: 4,744,180 R1471W possibly damaging Het
Thada T C 17: 84,416,323 E1101G probably damaging Het
Trpm6 G A 19: 18,829,990 A1033T probably damaging Het
Ttll6 G A 11: 96,158,727 R757H probably benign Het
Other mutations in Rangrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02431:Rangrf APN 11 68972739 missense probably benign 0.00
R0611:Rangrf UTSW 11 68972692 missense probably benign 0.13
R4450:Rangrf UTSW 11 68975184 unclassified probably benign
R4850:Rangrf UTSW 11 68973640 critical splice donor site probably null
R6341:Rangrf UTSW 11 68972712 missense probably benign 0.23
R6526:Rangrf UTSW 11 68973688 missense probably damaging 1.00
R7755:Rangrf UTSW 11 68973714 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCGAGCCTGGTCTGCTATTG -3'
(R):5'- AGTACTAGATCTATGGAGCCCAAC -3'

Sequencing Primer
(F):5'- GAGTTTTCGTCCTGAATAACCG -3'
(R):5'- CAGAAACTGTCCACTGTTCGGAG -3'
Posted On2018-06-06