Incidental Mutation 'R6453:Garem1'
ID 520136
Institutional Source Beutler Lab
Gene Symbol Garem1
Ensembl Gene ENSMUSG00000042680
Gene Name GRB2 associated regulator of MAPK1 subtype 1
Synonyms LOC381126, Garem, Fam59a
MMRRC Submission 044589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.228) question?
Stock # R6453 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 21260399-21433196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21281796 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 187 (I187F)
Ref Sequence ENSEMBL: ENSMUSP00000048914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049260]
AlphaFold Q3UFT3
Predicted Effect probably damaging
Transcript: ENSMUST00000049260
AA Change: I187F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: I187F

DomainStartEndE-ValueType
Pfam:CABIT 32 318 3.4e-79 PFAM
low complexity region 484 499 N/A INTRINSIC
low complexity region 512 518 N/A INTRINSIC
PDB:2DKZ|A 795 874 2e-40 PDB
Blast:SAM 808 875 2e-36 BLAST
SCOP:d1kw4a_ 812 873 4e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik C T 17: 35,879,109 (GRCm39) S149L possibly damaging Het
A830018L16Rik A T 1: 11,868,782 (GRCm39) D354V possibly damaging Het
Acta2 G A 19: 34,224,057 (GRCm39) T150I probably damaging Het
Adgra1 T A 7: 139,455,343 (GRCm39) S324T probably benign Het
Ankrd44 A T 1: 54,696,863 (GRCm39) probably null Het
B430306N03Rik T A 17: 48,623,764 (GRCm39) W22R probably damaging Het
Ccdc162 A T 10: 41,426,821 (GRCm39) V2024E probably damaging Het
Cers6 C T 2: 68,877,513 (GRCm39) H164Y probably benign Het
Chd3 T A 11: 69,240,938 (GRCm39) K1458* probably null Het
Cimip1 A G 2: 173,370,052 (GRCm39) Y109C probably benign Het
Col3a1 G A 1: 45,378,538 (GRCm39) probably benign Het
Cyb5d2 T G 11: 72,673,586 (GRCm39) T3P probably benign Het
Dennd1b A G 1: 139,071,686 (GRCm39) Y468C probably benign Het
Dnajc14 A G 10: 128,643,359 (GRCm39) E427G probably damaging Het
Exoc7 T C 11: 116,184,795 (GRCm39) probably null Het
Fat2 A G 11: 55,173,042 (GRCm39) I2557T probably benign Het
Flt1 T C 5: 147,620,751 (GRCm39) D131G possibly damaging Het
Frem1 G T 4: 82,833,062 (GRCm39) S1858* probably null Het
Gldc A T 19: 30,093,917 (GRCm39) I700N probably damaging Het
Gpatch4 A G 3: 87,962,312 (GRCm39) E175G probably damaging Het
Gria2 A G 3: 80,648,281 (GRCm39) Y152H possibly damaging Het
H2-Q2 C T 17: 35,563,871 (GRCm39) L251F probably benign Het
Hectd4 G A 5: 121,488,655 (GRCm39) G3649R probably damaging Het
Hormad1 A G 3: 95,485,568 (GRCm39) E252G probably benign Het
Kif14 A G 1: 136,410,042 (GRCm39) probably null Het
Lmcd1 A G 6: 112,292,789 (GRCm39) T214A probably benign Het
Macrod2 A G 2: 142,018,545 (GRCm39) E226G probably damaging Het
Mcm4 A T 16: 15,448,273 (GRCm39) L428Q probably damaging Het
Msh6 T A 17: 88,293,167 (GRCm39) Y641N probably damaging Het
Myo7a C T 7: 97,722,374 (GRCm39) V1184M probably benign Het
Nipa2 A T 7: 55,585,569 (GRCm39) M142K probably damaging Het
Or8b1c T C 9: 38,384,871 (GRCm39) I276T probably benign Het
Parvg A T 15: 84,213,126 (GRCm39) E122V probably null Het
Pclo T A 5: 14,726,803 (GRCm39) probably benign Het
Pik3cd A G 4: 149,736,759 (GRCm39) V933A probably damaging Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Qpctl C T 7: 18,875,222 (GRCm39) V337I probably damaging Het
Qrfprl G A 6: 65,430,014 (GRCm39) G237S possibly damaging Het
Ralgapa1 A G 12: 55,785,104 (GRCm39) W719R probably damaging Het
Rangrf A G 11: 68,864,378 (GRCm39) L28P probably damaging Het
Rbbp9 G T 2: 144,391,054 (GRCm39) Q38K probably benign Het
Rnf169 C T 7: 99,584,434 (GRCm39) M246I probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,124 (GRCm39) probably benign Het
Sdk1 A G 5: 142,082,676 (GRCm39) D1098G probably damaging Het
Sgsm3 T A 15: 80,895,515 (GRCm39) S689T probably damaging Het
Slc13a3 C T 2: 165,253,867 (GRCm39) V429M possibly damaging Het
Slc30a5 A T 13: 100,951,197 (GRCm39) D228E probably benign Het
Slc46a3 A G 5: 147,823,200 (GRCm39) I214T possibly damaging Het
Slc7a15 T C 12: 8,584,490 (GRCm39) M347V possibly damaging Het
Slc9a2 A T 1: 40,781,781 (GRCm39) I337F possibly damaging Het
Sostdc1 C A 12: 36,364,407 (GRCm39) P39T probably benign Het
Speg A G 1: 75,394,616 (GRCm39) N1775S probably benign Het
Spg7 A G 8: 123,806,162 (GRCm39) K291E possibly damaging Het
Sptbn2 A T 19: 4,794,208 (GRCm39) R1471W possibly damaging Het
Thada T C 17: 84,723,751 (GRCm39) E1101G probably damaging Het
Trpm6 G A 19: 18,807,354 (GRCm39) A1033T probably damaging Het
Ttll6 G A 11: 96,049,553 (GRCm39) R757H probably benign Het
Other mutations in Garem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Garem1 APN 18 21,281,714 (GRCm39) missense probably damaging 1.00
IGL01588:Garem1 APN 18 21,262,854 (GRCm39) missense probably damaging 0.99
IGL02171:Garem1 APN 18 21,262,298 (GRCm39) missense probably damaging 0.98
IGL02270:Garem1 APN 18 21,281,507 (GRCm39) missense probably damaging 1.00
IGL03149:Garem1 APN 18 21,264,523 (GRCm39) missense probably damaging 1.00
R0136:Garem1 UTSW 18 21,263,048 (GRCm39) missense probably damaging 0.96
R0285:Garem1 UTSW 18 21,262,669 (GRCm39) missense probably benign
R0361:Garem1 UTSW 18 21,432,801 (GRCm39) nonsense probably null
R1068:Garem1 UTSW 18 21,301,812 (GRCm39) missense probably benign 0.00
R1537:Garem1 UTSW 18 21,301,931 (GRCm39) splice site probably null
R1726:Garem1 UTSW 18 21,281,319 (GRCm39) missense probably damaging 0.99
R1826:Garem1 UTSW 18 21,262,509 (GRCm39) missense probably benign 0.00
R2140:Garem1 UTSW 18 21,262,431 (GRCm39) missense probably damaging 1.00
R3714:Garem1 UTSW 18 21,281,947 (GRCm39) missense probably damaging 1.00
R3937:Garem1 UTSW 18 21,281,863 (GRCm39) nonsense probably null
R4362:Garem1 UTSW 18 21,369,172 (GRCm39) missense possibly damaging 0.62
R4441:Garem1 UTSW 18 21,301,807 (GRCm39) missense possibly damaging 0.92
R4747:Garem1 UTSW 18 21,263,000 (GRCm39) missense probably benign
R4814:Garem1 UTSW 18 21,281,173 (GRCm39) missense probably damaging 1.00
R4831:Garem1 UTSW 18 21,262,825 (GRCm39) missense probably benign 0.01
R4838:Garem1 UTSW 18 21,280,950 (GRCm39) missense probably benign 0.00
R5805:Garem1 UTSW 18 21,281,492 (GRCm39) missense probably benign 0.04
R5963:Garem1 UTSW 18 21,262,487 (GRCm39) missense probably benign 0.45
R5982:Garem1 UTSW 18 21,281,408 (GRCm39) missense possibly damaging 0.64
R6134:Garem1 UTSW 18 21,262,881 (GRCm39) missense probably benign 0.00
R6242:Garem1 UTSW 18 21,262,229 (GRCm39) missense possibly damaging 0.72
R6485:Garem1 UTSW 18 21,262,894 (GRCm39) missense probably benign 0.00
R6596:Garem1 UTSW 18 21,281,796 (GRCm39) missense probably damaging 0.99
R6662:Garem1 UTSW 18 21,281,304 (GRCm39) missense probably benign 0.45
R6883:Garem1 UTSW 18 21,262,769 (GRCm39) missense probably benign
R6937:Garem1 UTSW 18 21,280,827 (GRCm39) missense probably benign 0.00
R7027:Garem1 UTSW 18 21,263,051 (GRCm39) missense probably benign
R7256:Garem1 UTSW 18 21,281,811 (GRCm39) missense probably damaging 1.00
R7534:Garem1 UTSW 18 21,432,973 (GRCm39) start gained probably benign
R7620:Garem1 UTSW 18 21,262,898 (GRCm39) missense probably benign
R7869:Garem1 UTSW 18 21,432,757 (GRCm39) missense probably damaging 1.00
R7963:Garem1 UTSW 18 21,281,844 (GRCm39) missense probably damaging 0.98
R8058:Garem1 UTSW 18 21,281,621 (GRCm39) missense probably damaging 1.00
R8953:Garem1 UTSW 18 21,264,388 (GRCm39) critical splice donor site probably null
R9273:Garem1 UTSW 18 21,281,274 (GRCm39) missense probably damaging 0.99
R9411:Garem1 UTSW 18 21,369,057 (GRCm39) critical splice donor site probably null
R9475:Garem1 UTSW 18 21,281,370 (GRCm39) missense probably benign 0.00
R9789:Garem1 UTSW 18 21,262,985 (GRCm39) missense possibly damaging 0.81
Z1176:Garem1 UTSW 18 21,281,382 (GRCm39) missense probably damaging 1.00
Z1176:Garem1 UTSW 18 21,262,849 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCACTGTCACATTCACG -3'
(R):5'- TGCTTCACTAATGTGGAATTCGG -3'

Sequencing Primer
(F):5'- ACTGTCACATTCACGGGGAGTC -3'
(R):5'- CACTAATGTGGAATTCGGTTTATCG -3'
Posted On 2018-06-06